or
or
Exact

Results for "CDKL5"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDKL5     1-0986-003chrX:
18570371-18570376
AAAGAAAAAintronicDe novo--Yuen2017 G
CDKL5     M01813chrX:
18668586-18668586
CTexonicDe novostopgainNM_003159
NM_001037343
c.C2854T
c.C2854T
p.R952X
p.R952X
38.01.0E-4Guo2018 T
Li2017 T
Stessman2017 T
Wang2016 T
CDKL5     14153.p1chrX:
18534425-18534425
GTintronicDe novo--Turner2016 G
CDKL5     7-0251-003chrX:
18669380-18669381
TGTGAGintronicDe novo--Yuen2017 G
CDKL5     M08767chrX:
18643288-18643288
ATexonicPaternalnonsynonymous SNVNM_003159
NM_001037343
c.A2417T
c.A2417T
p.K806I
p.K806I
28.4-Guo2018 T
CDKL5     M20612chrX:
18606108-18606108
GCexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.G589C
c.G589C
p.V197L
p.V197L
28.6-Guo2018 T
Wang2016 T
CDKL5     80001101063chrX:
18602382-18602382
GCsplicingDe novosplicing14.61-Satterstrom2020 E
CDKL5     M18380chrX:
18622630-18622630
GCexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.G1586C
c.G1586C
p.S529T
p.S529T
11.192.28E-5Guo2018 T
Wang2016 T
CDKL5     AU3263302chrX:
18511547-18511548
ACACCintronicDe novo--Yuen2017 G
CDKL5     GX0251.p1chrX:
18627650-18627650
CGexonicDe novostopgainNM_003159
NM_001037343
c.C2112G
c.C2112G
p.Y704X
p.Y704X
41.0-Guo2018 T
CDKL5     Schaaf2011:22chrX:
18671608-18671608
GAexonicUnknownnonsynonymous SNVNM_003159
NM_001037343
c.G3037A
c.G3037A
p.V1013I
p.V1013I
10.941.192E-5Schaaf2011 T
CDKL5     7-0219-003chrX:
18655543-18655551
ATGGTGGTGATGGTGGTGGTGintronicDe novo--Yuen2017 G
CDKL5     M08425chrX:
18622765-18622765
CTexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.C1721T
c.C1721T
p.P574L
p.P574L
15.994.558E-5Guo2018 T
CDKL5     Li2017:20272chrX:
18622983-18622983
CAexonicUnknownnonsynonymous SNVNM_003159
NM_001037343
c.C1939A
c.C1939A
p.P647T
p.P647T
20.5-Li2017 T
CDKL5     AU095803chrX:
18668586-18668586
CTexonicMaternalstopgainNM_003159
NM_001037343
c.C2854T
c.C2854T
p.R952X
p.R952X
38.01.0E-4Zhou2019 T
CDKL5     M10006chrX:
18631388-18631388
GAexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.G2269A
c.G2269A
p.D757N
p.D757N
29.11.14E-5Guo2018 T
CDKL5     Schaaf2011:21chrX:
18616706-18616706
AGexonicUnknownnonsynonymous SNVNM_003159
NM_001037343
c.A950G
c.A950G
p.H317R
p.H317R
17.442.281E-5Schaaf2011 T
CDKL5     Yamamoto2019:5chrX:
18627017-18627018
ACAexonicDe novoframeshift deletionNM_003159
NM_001037343
c.2032delC
c.2032delC
p.R678fs
p.R678fs
--Yamamoto2019 T
CDKL5     M26902chrX:
18622045-18622045
CTexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.C1001T
c.C1001T
p.A334V
p.A334V
15.11-Guo2018 T
CDKL5     M20272chrX:
18622983-18622983
CAexonicMaternal, Unknownnonsynonymous SNVNM_003159
NM_001037343
c.C1939A
c.C1939A
p.P647T
p.P647T
20.5-Guo2018 T
Wang2016 T
CDKL5     M13442chrX:
18638000-18638000
AGexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.A2290G
c.A2290G
p.N764D
p.N764D
14.52-Wang2016 T
CDKL5     Codina-Sola2015:ASD_1chrX:
18622984-18622984
CTexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.C1940T
c.C1940T
p.P647L
p.P647L
22.6-Codina-Sola2015 E
CDKL5     M26436chrX:
18668586-18668586
CTexonicMaternalstopgainNM_003159
NM_001037343
c.C2854T
c.C2854T
p.R952X
p.R952X
38.01.0E-4Wang2016 T
CDKL5     AU2433302chrX:
18573392-18573398
ACCCCCCACCCCCCCintronicDe novo--Yuen2017 G
CDKL5     HN0034.p1chrX:
18671639-18671639
AGexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.A3068G
c.A3068G
p.E1023G
p.E1023G
12.92-Guo2018 T
CDKL5     GX0214.p1chrX:
18668599-18668599
GAexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.G2867A
c.G2867A
p.R956H
p.R956H
12.325.697E-5Guo2018 T
CDKL5     60-2027chrX:
18639774-18639774
GAintronicInherited--Michaelson2012 G
CDKL5     AU1909304chrX:
18470939-18470968
GTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTTTintronicDe novo--Yuen2017 G
CDKL5     GX0316.p1chrX:
18622983-18622983
CAexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.C1939A
c.C1939A
p.P647T
p.P647T
20.5-Guo2018 T
CDKL5     M30813chrX:
18622630-18622630
GCexonicMaternalnonsynonymous SNVNM_003159
NM_001037343
c.G1586C
c.G1586C
p.S529T
p.S529T
11.192.28E-5Guo2018 T
CDKL5     Yin2020:139chrX:
18622431-18622431
AGexonicnonsynonymous SNVNM_003159
NM_001037343
c.A1387G
c.A1387G
p.K463E
p.K463E
13.932.288E-5Yin2020 T
CDKL5     Mahjani2021:139chrX:
18602382-18602382
GCsplicingsplicing14.61-Mahjani2021 E
CDKL5     GX0431.p1chrX:
18622983-18622983
CAexonicPaternalnonsynonymous SNVNM_003159
NM_001037343
c.C1939A
c.C1939A
p.P647T
p.P647T
20.5-Guo2018 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More