or
or
Exact

Results for "PHIP"

Variant Events: 52

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PHIP     14054.p1chr6:
79665395-79665395
GCexonicDe novononsynonymous SNVNM_017934c.C3787Gp.Q1263E13.63-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
PHIP     7-0249-004chr6:
79837661-79837676
ACTGCTGCTGCTGCTGACTGCTGCTGCTGintergenicDe novo--Yuen2017 G
PHIP     Stessman2017:ASD_1165chr6:
79655086-79655086
GAexonicUnknownnonsynonymous SNVNM_017934c.C4759Tp.R1587C21.58.238E-6Stessman2017 T
PHIP     GX0077.p1chr6:
79752720-79752720
GAexonicPaternalnonsynonymous SNVNM_017934c.C440Tp.A147V3.662.479E-5Guo2018 T
PHIP     M31875chr6:
79688358-79688358
GAexonicPaternalnonsynonymous SNVNM_017934c.C2840Tp.T947I22.1-Guo2018 T
PHIP     M3323chr6:
79695138-79695138
TCexonicPaternalnonsynonymous SNVNM_017934c.A2468Gp.E823G19.211.648E-5Wang2016 T
PHIP     HEN0281.p1chr6:
79664653-79664653
TG/TexonicMaternal--Guo2018 T
PHIP     HEN0251.p1chr6:
79655047-79655047
GA/GexonicMaternal--Guo2018 T
PHIP     M8757chr6:
79697996-79697996
CTexonicPaternalnonsynonymous SNVNM_017934c.G2390Ap.R797H17.72.474E-5Wang2016 T
PHIP     HEN0136.p1chr6:
79727264-79727264
AGexonicMaternalnonsynonymous SNVNM_017934c.T1031Cp.I344T14.378.329E-6Guo2018 T
PHIP     HN0189.p1chr6:
79698041-79698041
TC/TexonicMaternal--Guo2018 T
PHIP     14228.p1chr6:
79735235-79735240
CTTTATCexonicDe novoframeshift deletionNM_017934c.919_923delp.I307fs-8.287E-6Turner2017 G
Werling2018 G
Wilfert2021 G
PHIP     JS0062.p1chr6:
79651012-79651012
TC/TexonicMaternal--Guo2018 T
PHIP     2-1485-004chr6:
79746085-79746085
CTintronicDe novo--Yuen2017 G
PHIP     1-0395-003chr6:
79675895-79675895
CAintronicDe novo--Yuen2017 G
PHIP     M03323chr6:
79695138-79695138
TCexonicPaternalnonsynonymous SNVNM_017934c.A2468Gp.E823G19.211.648E-5Guo2018 T
PHIP     M08757chr6:
79697996-79697996
CTexonicPaternalnonsynonymous SNVNM_017934c.G2390Ap.R797H17.72.474E-5Guo2018 T
PHIP     1-0296-003chr6:
79897591-79897591
TCintergenicDe novo--Yuen2017 G
PHIP     14215.p1chr6:
79680570-79680570
GAexonicDe novosynonymous SNVNM_017934c.C2925Tp.V975V-3.509E-5Satterstrom2020 E
PHIP     M15191chr6:
79692757-79692757
TCexonicMaternalnonsynonymous SNVNM_017934c.A2615Gp.N872S12.348.256E-6Guo2018 T
Wang2016 T
PHIP     13012.p1chr6:
79657562-79657562
CTintronicMosaic--Dou2017 E
PHIP     SF0139970.p1chr6:
79770490-79770490
AGexonicDe novononsynonymous SNVNM_017934c.T235Cp.C79R23.4-Wang2020 T
PHIP     SF0073526.p1chr6:
79735702-79735703
CACexonicDe novoframeshift deletionNM_017934c.779delTp.L260fs--Wang2020 T
PHIP     M20730chr6:
79655019-79655019
TGexonicMaternalnonsynonymous SNVNM_017934c.A4826Cp.Q1609P8.768.241E-6Wang2016 T
PHIP     SD0349.p1chr6:
79735788-79735788
CTexonicUnknownnonsynonymous SNVNM_017934c.G694Ap.A232T28.7-Wang2020 T
Wang2020 T
PHIP     HEN432.p1chr6:
79664655-79664655
CTexonicUnknownnonsynonymous SNVNM_017934c.G3929Ap.R1310H23.0-Wang2020 T
Wang2020 T
PHIP     M23723chr6:
79680592-79680592
CTexonicUnknownnonsynonymous SNVNM_017934c.G2903Ap.R968Q19.839.898E-6Wang2020 T
Wang2020 T
PHIP     HEN0286.p1chr6:
79655085-79655085
CTexonicUnknownnonsynonymous SNVNM_017934c.G4760Ap.R1587H22.88.238E-6Wang2020 T
Wang2020 T
PHIP     M17483chr6:
79752571-79752571
GAexonicUnknownnonsynonymous SNVNM_017934c.C589Tp.R197W20.78.274E-6Wang2020 T
Wang2020 T
PHIP     GX0478.p1chr6:
79664656-79664656
GAexonicUnknownnonsynonymous SNVNM_017934c.C3928Tp.R1310C25.78.381E-6Wang2020 T
Wang2020 T
PHIP     ASDchr6:
79655086-79655086
GAexonicUnknownnonsynonymous SNVNM_017934c.C4759Tp.R1587C21.58.238E-6Wang2020 T
PHIP     M17563chr6:
79727285-79727285
GAexonicPaternalnonsynonymous SNVNM_017934c.C1010Tp.A337V26.81.674E-5Guo2018 T
Wang2016 T
PHIP     2-1485-003chr6:
79746085-79746085
CTintronicDe novo--Yuen2017 G
PHIP     M21714chr6:
79650639-79650639
AGexonicPaternalnonsynonymous SNVNM_017934c.T5237Cp.I1746T-1.647E-5Guo2018 T
Wang2016 T
PHIP     84824820chr6:
79656522-79656522
TAexonicUnknownstopgainNM_017934c.A4276Tp.K1426X43.0-Wang2020 T
Wang2020 T
PHIP     GX0485.p1chr6:
79679863-79679863
TGexonicMaternalnonsynonymous SNVNM_017934c.A3025Cp.I1009L18.44-Guo2018 T
PHIP     7-0032-003chr6:
79770397-79770397
GAexonicDe novononsynonymous SNVNM_017934c.C328Tp.R110C21.0-Wang2020 T
Yuen2017 G
PHIP     GX0335.p1chr6:
79672819-79672819
GTexonicMaternalnonsynonymous SNVNM_017934c.C3530Ap.T1177K23.9-Guo2018 T
PHIP     HN0077.p1chr6:
79735718-79735718
CTexonicMaternalnonsynonymous SNVNM_017934c.G764Ap.R255Q17.38-Guo2018 T
PHIP     GX0515.p1chr6:
79727264-79727264
AGexonicMaternalnonsynonymous SNVNM_017934c.T1031Cp.I344T14.378.329E-6Guo2018 T
PHIP     GX0396.p1chr6:
79655879-79655879
TCexonicMaternalnonsynonymous SNVNM_017934c.A4469Gp.N1490S2.7481.648E-5Guo2018 T
PHIP     M15024 Complex Event; expand row to view variants  De novoframeshift deletionNM_017934
NM_017934
c.5300_5301del
c.5299_5300del
p.R1767fs
p.R1767fs
--Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
PHIP     ASD1165chr6:
79655086-79655086
GAexonicUnknownnonsynonymous SNVNM_017934c.C4759Tp.R1587C21.58.238E-6Wang2020 T
PHIP     60757044chr6:
79724852-79724852
CTexonicUnknownnonsynonymous SNVNM_017934c.G1471Ap.V491M18.51-Wang2020 T
Wang2020 T
PHIP     HEN0180.p1chr6:
79655763-79655763
TC/TexonicPaternal--Guo2018 T
PHIP     HEN0310.p1chr6:
79672862-79672862
CC/TexonicPaternal--Guo2018 T
PHIP     327904chr6:
79650649-79650649
GAexonicInherited, UnknownstopgainNM_017934c.C5227Tp.R1743X41.0-Stessman2017 T
Wang2020 T
Wang2020 T
PHIP     1-0604-003chr6:
79699336-79699340
ATGTGATGintronicDe novo--Yuen2017 G
PHIP     M20573chr6:
79679845-79679845
ATexonicPaternalnonsynonymous SNVNM_017934c.T3043Ap.L1015I17.54-Wang2016 T
PHIP     F9602-1chr6:
79672908-79672909
TATexonicDe novoframeshift deletionNM_017934c.3440delTp.L1147fs--Satterstrom2020 E
PHIP     1-0395-004chr6:
79675895-79675895
CAintronicDe novo--Yuen2017 G
PHIP     MR432chr6:
79726310-79726310
GAexonicDe novostopgainNM_017934c.C1186Tp.R396X39.0-Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More