or
or
Exact

Results for "GLI2"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GLI2     1-0417-003chr2:
121625597-121625597
CTintronicDe novo--Yuen2016 G
GLI2     AU4150301chr2:
121840581-121840581
ACintergenicDe novo--Yuen2017 G
GLI2     M21633chr2:
121708877-121708877
CTexonicPaternalnonsynonymous SNVNM_005270c.C313Tp.P105S35.0-Guo2018 T
Wang2016 T
GLI2     2-1252-003chr2:
121820327-121820327
GAintergenicDe novo--Yuen2017 G
GLI2     D3G5Achr2:
121736074-121736074
CTexonicUnknownnonsynonymous SNVNM_005270c.C1433Tp.T478M19.841.652E-5Stessman2017 T
GLI2     M08455chr2:
121744056-121744056
GAexonicMaternalnonsynonymous SNVNM_005270c.G2159Ap.R720H33.05.0E-4Guo2018 T
Wang2016 T
GLI2     2-1466-003chr2:
121648338-121648338
GAintronicDe novo--Yuen2017 G
GLI2     M08725chr2:
121744100-121744100
GAexonicMaternalnonsynonymous SNVNM_005270c.G2203Ap.E735K36.01.652E-5Guo2018 T
Wang2016 T
GLI2     AU1795301chr2:
121857766-121857766
TAintergenicDe novo--Yuen2017 G
GLI2     Z4A7Ychr2:
121554977-121554991
CCCGGGTAAAAAGGCCexonicInheritedframeshift deletionNM_005270c.82_95delp.P28fs--Stessman2017 T
GLI2     2-1114-003chr2:
121841031-121841031
CTintergenicDe novo--Yuen2017 G
GLI2     AU1107301chr2:
121726332-121726332
GAexonicInheritednonsynonymous SNVNM_005270c.G686Ap.R229H35.01.659E-5Stessman2017 T
GLI2     2-1168-003chr2:
121921736-121921736
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
GLI2     AU3052302chr2:
121569047-121569047
CTintronicDe novo--Yuen2017 G
GLI2     AU002903chr2:
121784698-121784698
GAintergenicDe novo--Yuen2017 G
GLI2     215-13035-0443chr2:
121743929-121743929
GAexonicInheritednonsynonymous SNVNM_005270c.G2032Ap.D678N35.0-Stessman2017 T
GLI2     14110.p1chr2:
121732630-121732630
ACexonicDe novononsynonymous SNVNM_005270c.A1313Cp.N438T19.881.0E-4Satterstrom2020 E
GLI2     AU021503chr2:
121736022-121736022
GAexonicUnknownnonsynonymous SNVNM_005270c.G1381Ap.E461K20.8-Stessman2017 T
GLI2     AU2089302chr2:
121891752-121891758
TGTAAGTTGTintergenicDe novo--Yuen2017 G
GLI2     2-1280-003chr2:
121830877-121830894
GACACACACACACACACAGACACACACACACACAintergenicDe novo--Yuen2017 G
GLI2     AU2792302chr2:
121799562-121799562
CTintergenicDe novo--Yuen2017 G
GLI2     5-0061-003chr2:
121828313-121828313
AGintergenicDe novo--Yuen2017 G
GLI2     PN400301chr2:
121726338-121726338
GAexonicUnknownnonsynonymous SNVNM_005270c.G692Ap.R231Q36.08.289E-6Leblond2019 E
GLI2     GX0494.p1chr2:
121708869-121708869
GAexonicUnknownnonsynonymous SNVNM_005270c.G305Ap.R102Q34.01.0E-4Guo2018 T
GLI2     M23240chr2:
121740401-121740401
CGexonicMaternalnonsynonymous SNVNM_005270c.C1628Gp.A543G32.02.0E-4Wang2016 T
GLI2     2-1317-003chr2:
121721013-121721031
TTGTGTGTGTGTGTGTGTGTTGTGTGTGTGTGTGTGintronicDe novo--Yuen2017 G
GLI2     1-0554-003chr2:
121786886-121786886
CTintergenicDe novo--Yuen2017 G
GLI2     2-1297-003chr2:
121815944-121815944
AGintergenicDe novo--Yuen2017 G
GLI2     AU3885304chr2:
121709151-121709151
TAintronicDe novo--Yuen2017 G
GLI2     PN400470chr2:
121742123-121742123
CTexonicUnknownnonsynonymous SNVNM_005270c.C1760Tp.T587M25.32.472E-5Leblond2019 E
GLI2     2-1334-003chr2:
121597953-121597954
ACAintronicDe novo--Yuen2016 G
Yuen2017 G
GLI2     M08563chr2:
121740401-121740401
CGexonicPaternalnonsynonymous SNVNM_005270c.C1628Gp.A543G32.02.0E-4Wang2016 T
GLI2     AU4007302chr2:
121576899-121576899
CTintronicDe novo--Yuen2017 G
GLI2     2-0007-004chr2:
121822904-121822904
AAGintergenicDe novo--Yuen2017 G
GLI2     220-9834-201chr2:
121728108-121728108
AGexonicInheritednonsynonymous SNVNM_005270c.A985Gp.M329V10.841.649E-5Stessman2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More