or
or
Exact

Results for "ADGRL2"

Variant Events: 75

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADGRL2     2-1456-004chr1:
83022813-83022813
GAintergenicDe novo--Yuen2017 G
ADGRL2     AU2863303chr1:
83025229-83025229
GAintergenicDe novo--Yuen2017 G
ADGRL2     AU2427302chr1:
82324642-82324642
TGintronicDe novo--Yuen2017 G
ADGRL2     AU1848302chr1:
82259120-82259120
TCintronicDe novo--Yuen2017 G
ADGRL2     2-1451-003chr1:
83012478-83012478
CTintergenicDe novo--Yuen2017 G
ADGRL2     1-0458-003chr1:
83071570-83071570
GAintergenicDe novo--Yuen2017 G
ADGRL2     AU4122301chr1:
82531771-82531771
CGintergenicDe novo--Yuen2017 G
ADGRL2     5-0131-003chr1:
82261211-82261214
AAACAintronicDe novo--Yuen2017 G
ADGRL2     1-0271-003chr1:
82365772-82365772
CTintronicDe novo--Yuen2017 G
ADGRL2     Stessman2017:ASD-1702chr1:
82450367-82450367
CTexonicUnknownnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.C3332T
c.C3332T
c.C3332T
c.C3332T
p.T1111I
p.T1111I
p.T1111I
p.T1111I
28.7-Stessman2017 T
ADGRL2     2-0286-004chr1:
82556453-82556453
AGintergenicDe novo--Yuen2017 G
ADGRL2     2-1292-004chr1:
82473684-82473684
TTTCCintergenicDe novo--Yuen2017 G
ADGRL2     2-1632-003chr1:
83261617-83261617
GAintergenicDe novo--Yuen2017 G
ADGRL2     1-0514-003chr1:
82428716-82428716
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ADGRL2     1-0354-006chr1:
83381906-83381906
GAintergenicDe novo--Yuen2017 G
ADGRL2     AU4013301chr1:
83136886-83136886
TCintergenicDe novo--Yuen2017 G
ADGRL2     Li2017:19628chr1:
82445557-82445557
ATexonicUnknownnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.A2975T
c.A2975T
c.A2975T
c.A2975T
p.N992I
p.N992I
p.N992I
p.N992I
16.94-Li2017 T
ADGRL2     2-0043-003chr1:
82447330-82447330
AGintronicDe novo--Yuen2016 G
ADGRL2     2-0149-004chr1:
82245493-82245493
CGintronicDe novo--Yuen2017 G
ADGRL2     2-1066-003chr1:
82895244-82895244
AGintergenicDe novo--Yuen2017 G
ADGRL2     1-0469-003chr1:
83002769-83002769
TGintergenicDe novo--Yuen2017 G
ADGRL2     3-0391-000chr1:
83021657-83021657
GAintergenicDe novo--Yuen2017 G
ADGRL2     AU058105chr1:
82935288-82935288
TCintergenicDe novo--Yuen2017 G
ADGRL2     M18470chr1:
82434986-82434986
GAexonicPaternalnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.G2597A
c.G2597A
c.G2597A
c.G2597A
p.R866Q
p.R866Q
p.R866Q
p.R866Q
34.04.943E-5Guo2018 T
Wang2016 T
ADGRL2     1-0513-003chr1:
82918045-82918049
TGGGGTGGGGGintergenicDe novo--Yuen2017 G
ADGRL2     1-0701-003chr1:
83421503-83421503
CTintergenicDe novo--Yuen2017 G
ADGRL2     A17chr1:
82814034-82814034
GAintergenicDe novo--Wu2018 G
ADGRL2     AU4315302chr1:
82539288-82539288
GAintergenicDe novo--Yuen2017 G
ADGRL2     13874.p1chr1:
82558496-82558496
CTintergenicDe novo--Turner2016 G
ADGRL2     AU3635301chr1:
82396464-82396464
CAintronicDe novo--Yuen2017 G
ADGRL2     1-0305-004chr1:
82486002-82486002
AGintergenicDe novo--Yuen2017 G
ADGRL2     2-1169-004chr1:
82821626-82821626
CAintergenicDe novo--Yuen2017 G
ADGRL2     1-0885-003chr1:
82686810-82686810
CTintergenicDe novo--Yuen2017 G
ADGRL2     2-0299-005chr1:
82927562-82927562
CTintergenicDe novo--Yuen2017 G
ADGRL2     AU4237304chr1:
83325780-83325780
AGintergenicDe novo--Yuen2017 G
ADGRL2     1-0453-003chr1:
82608471-82608471
CTintergenicDe novo--Yuen2017 G
ADGRL2     U6G2Jchr1:
82435043-82435043
TCexonicUnknownnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.T2654C
c.T2654C
c.T2654C
c.T2654C
p.L885P
p.L885P
p.L885P
p.L885P
22.72.473E-5Stessman2017 T
ADGRL2     AU3692301chr1:
82634737-82634737
TCintergenicDe novo--Yuen2017 G
ADGRL2     2-0022-004chr1:
83334355-83334355
ACintergenicDe novo--Yuen2017 G
ADGRL2     AU3858302chr1:
83427744-83427744
TCintergenicDe novo--Yuen2017 G
ADGRL2     AU3761301 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
ADGRL2     1-1000-003chr1:
82256055-82256068
AACACACACACACAAACACACACACAintronicDe novo--Yuen2017 G
ADGRL2     1-0285-003chr1:
82918261-82918261
GTintergenicDe novo--Yuen2017 G
ADGRL2     1-0652-003chr1:
83267229-83267229
AGintergenicDe novo--Yuen2017 G
ADGRL2     SSC07524chr1:
82434968-82434968
GAexonicDe novononsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.G2579A
c.G2579A
c.G2579A
c.G2579A
p.R860H
p.R860H
p.R860H
p.R860H
33.08.237E-5Lim2017 E
ADGRL2     2-0244-003chr1:
83161872-83161872
GAintergenicDe novo--Yuen2017 G
ADGRL2     AU3721302chr1:
82779190-82779190
CAintergenicDe novo--Yuen2017 G
ADGRL2     2-1105-003chr1:
82988853-82988853
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRL2     Li2017:20250chr1:
82408707-82408707
ACexonicUnknownnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.A452C
c.A452C
c.A452C
c.A452C
p.E151A
p.E151A
p.E151A
p.E151A
18.436.637E-5Li2017 T
ADGRL2     74-0688chr1:
83154515-83154515
CTintergenicDe novo--Michaelson2012 G
ADGRL2     10C109058chr1:
82447466-82447467
TATintronicDe novo-8.314E-6Satterstrom2020 E
ADGRL2     217-14403-5120chr1:
82445619-82445619
GAexonicMaternalnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.G3037A
c.G3037A
c.G3037A
c.G3037A
p.D1013N
p.D1013N
p.D1013N
p.D1013N
33.0-Stessman2017 T
ADGRL2     AU4485302chr1:
82630758-82630758
AGintergenicDe novo--Yuen2017 G
ADGRL2     1-0412-003chr1:
82465947-82465947
CGintergenicDe novo--Yuen2017 G
ADGRL2     13496.p1chr1:
82434968-82434968
GAexonicDe novononsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.G2579A
c.G2579A
c.G2579A
c.G2579A
p.R860H
p.R860H
p.R860H
p.R860H
33.08.237E-5Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
ADGRL2     A18chr1:
82565055-82565055
TAintergenicDe novo--Wu2018 G
ADGRL2     AU2950301chr1:
83392841-83392841
TCintergenicDe novo--Yuen2017 G
ADGRL2     2-1297-003chr1:
82748973-82748973
GGGAintergenicDe novo--Yuen2017 G
ADGRL2     2-1337-003chr1:
82542762-82542762
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRL2     AU3343301chr1:
82658115-82658115
AGintergenicDe novo--Yuen2017 G
ADGRL2     AU3763305chr1:
82299722-82299722
AGintronicDe novo--Yuen2017 G
ADGRL2     7-0143-003chr1:
82822924-82822940
GCTGAGCCTGAGCCTGAGCTGAGCCTGAGCCTGAGCCTGAintergenicDe novo--Yuen2017 G
ADGRL2     1-0368-004chr1:
82618671-82618671
CTintergenicDe novo--Yuen2017 G
ADGRL2     2-0273-003chr1:
83211056-83211056
TCintergenicDe novo--Yuen2017 G
ADGRL2     AU2433303chr1:
82669537-82669537
GAintergenicDe novo--Yuen2017 G
ADGRL2     AU1404301chr1:
82304204-82304205
TATintronicDe novo--Yuen2017 G
ADGRL2     101443-100chr1:
82266199-82266199
TAsplicingInheritedsplicing--Stessman2017 T
ADGRL2     AU3862305chr1:
83162701-83162701
AGintergenicDe novo--Yuen2017 G
ADGRL2     1-0255-003chr1:
83036761-83036761
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRL2     2-1384-003chr1:
82846410-82846410
GTintergenicDe novo--Yuen2017 G
ADGRL2     AU025704chr1:
82596946-82596946
AGintergenicDe novo--Yuen2017 G
ADGRL2     M20398chr1:
82434986-82434986
GAexonicMaternalnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.G2597A
c.G2597A
c.G2597A
c.G2597A
p.R866Q
p.R866Q
p.R866Q
p.R866Q
34.04.943E-5Wang2016 T
ADGRL2     2-1066-004chr1:
82656520-82656520
ATintergenicDe novo--Yuen2017 G
ADGRL2     1-0045-003chr1:
83430291-83430297
TAGTCTCTintergenicDe novo--Yuen2017 G
ADGRL2     2-1066-004chr1:
82311905-82311905
TAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More