or
or
Exact

Results for "MYT1L"

Variant Events: 102

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MYT1L     2-0003-004chr2:
2223562-2223562
AGintronicDe novo--Yuen2017 G
MYT1L     AU3853302chr2:
2790259-2790259
GAintergenicDe novo--Yuen2017 G
MYT1L     2-1452-003chr2:
2008538-2008538
AGintronicDe novo--Yuen2017 G
MYT1L     M8524chr2:
1926150-1926150
GAexonicUnknownnonsynonymous SNVNM_001303052
NM_015025
c.C1391T
c.C1391T
p.S464L
p.S464L
2.626-Wang2016 T
MYT1L     2-0306-004chr2:
1976908-1976922
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintronicDe novo--Yuen2017 G
MYT1L     AU002404chr2:
1805544-1805544
TAexonicUnknownnonsynonymous SNVNM_001303052
NM_015025
c.A3200T
c.A3194T
p.Q1067L
p.Q1065L
24.31.657E-5Wang2020 T
Wang2020 T
Wang2020 T
MYT1L     AU2458303chr2:
2788801-2788801
AGintergenicDe novo--Yuen2017 G
MYT1L     AU4197301chr2:
2665649-2665649
GAintergenicDe novo--Yuen2017 G
MYT1L     1-0387-003chr2:
2322485-2322485
CTintronicDe novo--Yuen2016 G
MYT1L     M12507chr2:
1893037-1893037
GC/GexonicPaternal--Guo2018 T
MYT1L     M03563chr2:
1893047-1893047
CC/TexonicPaternal--Guo2018 T
MYT1L     AU4173301chr2:
2209429-2209429
CGintronicDe novo--Yuen2017 G
MYT1L     M19732chr2:
1983537-1983537
TCexonicMaternalnonsynonymous SNVNM_001303052
NM_015025
c.A13G
c.A13G
p.T5A
p.T5A
11.643.331E-5Wang2016 T
MYT1L     2-0214-003chr2:
1926776-1926780
ACTGTAexonicDe novoframeshift deletionNM_001303052
NM_015025
c.761_764del
c.761_764del
p.D254fs
p.D254fs
--Wang2020 T
MYT1L     14219.p1chr2:
2399177-2399187
TCCAAACTGTATintergenicDe novo--Wilfert2021 G
MYT1L     2-1415-004chr2:
2799357-2799357
CAintergenicDe novo--Yuen2017 G
MYT1L     M12510chr2:
1983308-1983308
AGexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.T74C
c.T74C
p.I25T
p.I25T
10.65-Guo2018 T
Wang2016 T
MYT1L     1-0065-005chr2:
2799357-2799357
CAintergenicDe novo--Yuen2017 G
MYT1L     1-0408-003chr2:
2237658-2237658
CAintronicDe novo--Yuen2016 G
Yuen2017 G
MYT1L     DEASD_0440_001chr2:
1893073-1893073
GAexonicDe novosynonymous SNVNM_001303052
NM_015025
c.C2460T
c.C2454T
p.P820P
p.P818P
-8.28E-6DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
MYT1L     DEASD_0057_001chr2:
1921023-1921023
GCexonicDe novononsynonymous SNVNM_001303052
NM_015025
c.C1572G
c.C1566G
p.H524Q
p.H522Q
19.46-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
MYT1L     2-1429-003chr2:
2799357-2799357
CAintergenicDe novo--Yuen2017 G
MYT1L     AU062Achr2:
1926950-1926950
GTexonicDe novostopgainNM_001303052
NM_015025
c.C591A
c.C591A
p.Y197X
p.Y197X
39.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
MYT1L     2-1350-004chr2:
2799346-2799346
GAintergenicDe novo--Yuen2017 G
MYT1L     AU2129303chr2:
2300639-2300639
GTintronicDe novo--Yuen2017 G
MYT1L     AU074503 Complex Event; expand row to view variants  Unknownframeshift deletionNM_001303052
NM_015025
NM_001303052
NM_015025
c.3328_3331del
c.3322_3325del
c.3329_3332del
c.3323_3326del
p.I1110fs
p.I1108fs
p.I1110fs
p.I1108fs
--Stessman2017 T
Wang2020 T
Wang2020 T
MYT1L     2-1362-003chr2:
2392569-2392569
ACintergenicDe novo--Yuen2017 G
MYT1L     209185chr2:
1914112-1914112
CTexonicUnknownnonsynonymous SNVNM_001303052
NM_015025
c.G1717A
c.G1711A
p.G573R
p.G571R
28.6-Wang2020 T
Wang2020 T
MYT1L     1-0274-004chr2:
1846306-1846306
CTintronicDe novo--Yuen2017 G
MYT1L     AU0636303chr2:
2073243-2073243
TCintronicDe novo--Yuen2017 G
MYT1L     2-0214-003chr2:
1841150-1841151
ACAintronicDe novo--Yuen2017 G
MYT1L     M08524chr2:
1926150-1926150
GAexonicMaternalnonsynonymous SNVNM_001303052
NM_015025
c.C1391T
c.C1391T
p.S464L
p.S464L
2.626-Guo2018 T
MYT1L     2-1085-003chr2:
1980568-1980568
ACintronicDe novo--Yuen2017 G
MYT1L     2-1514-003chr2:
2197851-2197865
CATATATATATATATCATATATATATATintronicDe novo--Yuen2017 G
MYT1L     AU036203chr2:
2647127-2647127
GAintergenicDe novo--Yuen2017 G
MYT1L     1-0629-003chr2:
2666072-2666072
GAintergenicDe novo--Yuen2017 G
MYT1L     2-1174-006chr2:
2098587-2098587
TTAintronicDe novo--Yuen2017 G
MYT1L     2-1605-003chr2:
2033880-2033880
TCintronicDe novo--Yuen2017 G
MYT1L     7-0168-003chr2:
2804933-2804938
AATCATAATintergenicDe novo--Yuen2017 G
MYT1L     HEN0306.p1chr2:
1893044-1893044
CTexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.G2489A
c.G2483A
p.R830K
p.R828K
14.35-Guo2018 T
MYT1L     AU4015302chr2:
2014712-2014712
CTintronicDe novo--Yuen2017 G
MYT1L     AU2075302chr2:
2717543-2717543
GTintergenicDe novo--Yuen2017 G
MYT1L     M21738chr2:
1893047-1893047
CTexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.G2486A
c.G2480A
p.R829Q
p.R827Q
14.154.142E-5Guo2018 T
Wang2016 T
MYT1L     12011.p1chr2:
2250356-2250356
CTintronicDe novo--Turner2016 G
MYT1L     14482.p1chr2:
2351884-2351884
GCintergenicDe novo--Turner2016 G
MYT1L     M12400chr2:
1983321-1983321
CTexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.G61A
c.G61A
p.V21M
p.V21M
16.972.488E-5Guo2018 T
Wang2016 T
MYT1L     M8704chr2:
1983537-1983537
TCexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.A13G
c.A13G
p.T5A
p.T5A
11.643.331E-5Wang2016 T
MYT1L     2-1264-003chr2:
2074383-2074383
TCintronicDe novo--Yuen2016 G
Yuen2017 G
MYT1L     M31968chr2:
1893018-1893018
TCexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.A2515G
c.A2509G
p.I839V
p.I837V
1.222-Guo2018 T
MYT1L     M3533chr2:
1805521-1805521
GCexonicMaternalnonsynonymous SNVNM_001303052
NM_015025
c.C3223G
c.C3217G
p.L1075V
p.L1073V
18.05-Wang2016 T
MYT1L     1-0481-003chr2:
2789920-2789920
CTintergenicDe novo--Yuen2017 G
MYT1L     1-0323-004chr2:
2693442-2693442
CAintergenicDe novo--Yuen2017 G
MYT1L     M32313chr2:
1926132-1926132
GAexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.C1409T
c.C1409T
p.P470L
p.P470L
2.3862.0E-4Guo2018 T
MYT1L     AU4033305chr2:
2696676-2696676
TAintergenicDe novo--Yuen2017 G
MYT1L     GX0051.p1chr2:
1926132-1926132
GAexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.C1409T
c.C1409T
p.P470L
p.P470L
2.3862.0E-4Guo2018 T
MYT1L     1-0508-003chr2:
2626152-2626152
ACintergenicDe novo--Yuen2017 G
MYT1L     M30874chr2:
1926651-1926651
AGexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.T890C
c.T890C
p.M297T
p.M297T
0.033-Guo2018 T
MYT1L     1-0489-003chr2:
2599839-2599839
TCintergenicDe novo--Yuen2017 G
MYT1L     M30904chr2:
1926363-1926363
GAexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.C1178T
c.C1178T
p.S393L
p.S393L
14.06-Guo2018 T
MYT1L     M31995chr2:
1983321-1983321
CTexonicPaternalnonsynonymous SNVNM_001303052
NM_015025
c.G61A
c.G61A
p.V21M
p.V21M
16.972.488E-5Guo2018 T
MYT1L     2-1166-003chr2:
2333589-2333589
GAintronicDe novo--Yuen2016 G
MYT1L     2-1633-003chr2:
1979951-1979951
CTintronicDe novo--Yuen2017 G
MYT1L     AU4487302chr2:
2617159-2617159
GAintergenicDe novo--Yuen2017 G
MYT1L     H5B6Cchr2:
1926586-1926586
CTexonicUnknownnonsynonymous SNVNM_001303052
NM_015025
c.G955A
c.G955A
p.D319N
p.D319N
26.9-Stessman2017 T
Wang2020 T
Wang2020 T
MYT1L     2-0318-004chr2:
2601720-2601720
GAintergenicDe novo--Yuen2017 G
MYT1L     SF0117834.p1chr2:
1893132-1893132
GAexonicDe novostopgainNM_001303052
NM_015025
c.C2401T
c.C2395T
p.Q801X
p.Q799X
47.0-Wang2020 T
MYT1L     1-0570-003chr2:
2399539-2399539
GCintergenicDe novo--Yuen2017 G
MYT1L     SF0108710.p1chr2:
1895817-1895817
CTexonicDe novononsynonymous SNVNM_001303052
NM_015025
c.G2275A
c.G2269A
p.A759T
p.A757T
12.21-Wang2020 T
MYT1L     5-0061-003chr2:
2427473-2427473
CTintergenicDe novo--Yuen2017 G
MYT1L     SF0087569.p2chr2:
1893188-1893188
GAexonicDe novononsynonymous SNVNM_001303052
NM_015025
c.C2345T
c.C2339T
p.P782L
p.P780L
11.312.495E-5Wang2020 T
MYT1L     SF0068071.p1chr2:
1947036-1947036
GAexonicDe novostopgainNM_001303052
NM_015025
c.C223T
c.C223T
p.R75X
p.R75X
41.0-Wang2020 T
MYT1L     AU2293301chr2:
2452502-2452502
CAintergenicDe novo--Yuen2017 G
MYT1L     ASC_142560chr2:
1893214-1893214
CTexonicDe novosynonymous SNVNM_001303052
NM_015025
c.G2319A
c.G2313A
p.L773L
p.L771L
--Satterstrom2020 E
MYT1L     1-0051-005chr2:
1976936-1976936
CTintronicDe novo--Yuen2017 G
MYT1L     AU3371305chr2:
2106473-2106473
GAintronicDe novo--Yuen2017 G
MYT1L     1-0294-003chr2:
2571929-2571929
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MYT1L     13898.p1chr2:
1921079-1921079
AGexonicDe novononsynonymous SNVNM_001303052
NM_015025
c.T1516C
c.T1510C
p.C506R
p.C504R
24.9-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
MYT1L     7-0253-005chr2:
2710417-2710417
CGintergenicDe novo--Yuen2017 G
MYT1L     AU3680301chr2:
2288244-2288244
CTUTR5De novo--Yuen2017 G
MYT1L     AU075803chr2:
2349694-2349694
AGintergenicDe novo--Yuen2017 G
MYT1L     M20699chr2:
1891360-1891360
GAexonicDe novostopgainNM_001303052
NM_015025
c.C2542T
c.C2536T
p.Q848X
p.Q846X
47.0-Guo2018 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
MYT1L     GX0176.p1chr2:
1843002-1843002
AGexonicMaternalnonsynonymous SNVNM_001303052
NM_015025
c.T2999C
c.T2993C
p.V1000A
p.V998A
13.04-Guo2018 T
MYT1L     513.101chr2:
1921003-1921003
GAexonicUnknownnonsynonymous SNVNM_001303052
NM_015025
c.C1592T
c.C1586T
p.P531L
p.P529L
35.0-Wang2020 T
Wang2020 T
MYT1L     GX0182.p1chr2:
1843002-1843002
AGexonicMaternalnonsynonymous SNVNM_001303052
NM_015025
c.T2999C
c.T2993C
p.V1000A
p.V998A
13.04-Guo2018 T
MYT1L     AU074504chr2:
1796180-1796184
CTCAACexonicUnknownframeshift deletionNM_001303052
NM_015025
c.3329_3332del
c.3323_3326del
p.I1110fs
p.I1108fs
--Wang2020 T
Wang2020 T
Wang2020 T
MYT1L     AU061104chr2:
2297549-2297549
GAintronicDe novo--Yuen2017 G
MYT1L     GX0247.p1chr2:
1926456-1926456
CTexonicMaternalnonsynonymous SNVNM_001303052
NM_015025
c.G1085A
c.G1085A
p.R362Q
p.R362Q
12.72-Guo2018 T
MYT1L     Mahjani2021:91chr2:
1921086-1921086
CGexonicnonsynonymous SNVNM_001303052
NM_015025
c.G1509C
c.G1503C
p.E503D
p.E501D
19.63-Mahjani2021 E
MYT1L     GX0194.p1chr2:
1796185-1796185
TCexonicMaternalnonsynonymous SNVNM_001303052
NM_015025
c.A3328G
c.A3322G
p.I1110V
p.I1108V
28.8-Guo2018 T
MYT1L     04C33840chr2:
1805544-1805544
TAexonicUnknownnonsynonymous SNVNM_001303052
NM_015025
c.A3200T
c.A3194T
p.Q1067L
p.Q1065L
24.31.657E-5Stessman2017 T
Wang2020 T
Wang2020 T
MYT1L     2-1174-005Bchr2:
2098587-2098587
TTAintronicDe novo--Yuen2017 G
MYT1L     1-0139-003chr2:
1835309-1835309
CTintronicDe novo--Yuen2017 G
MYT1L     G01-GEA-269-HIchr2:
1891323-1891324
ACAexonicDe novostopgainNM_001303052
NM_015025
c.2578delG
c.2572delG
p.V860X
p.V858X
--Satterstrom2020 E
MYT1L     1-0593-003chr2:
2006965-2006965
CTintronicDe novo--Yuen2017 G
MYT1L     1-0274-003chr2:
1846306-1846306
CTintronicDe novo--Yuen2017 G
MYT1L     2-1398-004chr2:
2386276-2386276
AGintergenicDe novo--Yuen2017 G
MYT1L     A1chr2:
2717671-2717671
ATintergenicDe novo--Wu2018 G
MYT1L     AU3915301chr2:
2576977-2576977
CCAAintergenicDe novo--Yuen2017 G
MYT1L     92chr2:
1891259-1891259
CTsplicingDe novosplicing18.58-O’Roak2014 T
MYT1L     2-0007-003chr2:
1804908-1804908
GAintronicDe novo--Yuen2017 G
MYT1L     2-1366-004chr2:
1858167-1858167
GAintronicDe novo--Yuen2017 G
MYT1L     AU3907302chr2:
2207275-2207275
ATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More