or
or
Exact

Results for "DLG2"

Variant Events: 140

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DLG2     1-0446-003chr11:
85221625-85221626
TCTintronicDe novo--Yuen2017 G
DLG2     2-0022-004chr11:
83617736-83617736
CAintronicDe novo--Yuen2017 G
DLG2     2-1215-003chr11:
84735482-84735482
AGintronicDe novo--Yuen2017 G
DLG2     EGAN00001101342chr11:
83770307-83770307
CTintronicDe novo--Satterstrom2020 E
DLG2     M13455chr11:
84245741-84245741
CTexonicPaternalnonsynonymous SNVNM_001300983
NM_001364
NM_001142699
c.G76A
c.G76A
c.G391A
p.D26N
p.D26N
p.D131N
36.0-Guo2018 T
Wang2016 T
DLG2     AU2756306chr11:
84252908-84252908
AGintronicDe novo--Yuen2017 G
DLG2     5-0109-003chr11:
85111530-85111530
TCintronicDe novo--Yuen2017 G
DLG2     AU4056302chr11:
85238880-85238880
CGintronicDe novo--Yuen2017 G
DLG2     2-1279-003chr11:
85014011-85014011
GAintronicDe novo--Yuen2016 G
Yuen2017 G
DLG2     2-0197-004chr11:
85010489-85010489
CCAintronicDe novo--Yuen2017 G
DLG2     AU4306302chr11:
84039759-84039759
CTintronicDe novo--Yuen2017 G
DLG2     1-0139-003chr11:
84900308-84900308
GAintronicDe novo--Yuen2017 G
DLG2     AU4093302chr11:
85217969-85217969
GAintronicDe novo--Yuen2017 G
DLG2     2-1734-003chr11:
85170304-85170304
GAintronicDe novo--Yuen2017 G
DLG2     1-0196-005chr11:
84837158-84837158
CTintronicDe novo--Yuen2017 G
DLG2     1-0196-005chr11:
84835146-84835146
ACintronicDe novo--Yuen2017 G
DLG2     2-1384-003chr11:
84273764-84273764
CAintronicDe novo--Yuen2017 G
DLG2     2-1164-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
DLG2     AU3853302chr11:
84122213-84122213
AGintronicDe novo--Yuen2017 G
DLG2     2-0323-004chr11:
85158052-85158052
GAintronicDe novo--Yuen2017 G
DLG2     1-0640-003chr11:
83337580-83337580
GAintronicDe novo--Yuen2017 G
DLG2     1-0751-003chr11:
84154192-84154192
TCintronicDe novo--Yuen2017 G
DLG2     2-1485-004chr11:
85109182-85109182
ATintronicDe novo--Yuen2017 G
DLG2     2-1526-003chr11:
83795886-83795886
AGintronicDe novo--Yuen2017 G
DLG2     2-1715-004chr11:
83778111-83778111
TGintronicDe novo--Yuen2017 G
DLG2     AU2019302chr11:
83325526-83325526
CAintronicDe novo--Yuen2017 G
DLG2     7-0100-004chr11:
83181652-83181652
CGintronicDe novo--Yuen2017 G
DLG2     7-0100-004chr11:
83188537-83188537
GCintronicDe novo--Yuen2017 G
DLG2     7-0100-004chr11:
83204859-83204859
GAintronicDe novo--Yuen2017 G
DLG2     AU3782302chr11:
85122418-85122418
CGintronicDe novo--Yuen2017 G
DLG2     2-1364-003chr11:
84937152-84937152
TAintronicDe novo--Yuen2017 G
DLG2     2-1112-003chr11:
83256787-83256787
GAintronicDe novo--Yuen2017 G
DLG2     AU3605303chr11:
85090292-85090292
CGintronicDe novo--Yuen2017 G
DLG2     M26816chr11:
84996409-84996410
TCTsplicingMaternalsplicing--Guo2018 T
Wang2016 T
DLG2     GX0350.p1chr11:
85337630-85337630
CAsplicingPaternalsplicing--Guo2018 T
DLG2     AU4154303chr11:
83812638-83812638
CAintronicDe novo--Yuen2017 G
DLG2     AU080203chr11:
83195273-83195275
TGTTintronicMaternal--Stessman2017 T
DLG2     2-1168-003chr11:
84947490-84947490
CGintronicDe novo--Yuen2016 G
Yuen2017 G
DLG2     M20570chr11:
83344294-83344294
CTexonicUnknownnonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G31A
c.G1276A
c.G1702A
c.G1585A
c.G1585A
c.G1900A
p.G11R
p.G426R
p.G568R
p.G529R
p.G529R
p.G634R
26.8-Stessman2017 T
DLG2     1-0160-004chr11:
84179153-84179153
TCintronicDe novo--Yuen2017 G
DLG2     2-1255-003chr11:
84830747-84830747
TCintronicDe novo--Yuen2017 G
DLG2     2-1567-004chr11:
83632642-83632642
CTintronicDe novo--Yuen2017 G
DLG2     1-0125-003chr11:
83614668-83614668
GAintronicDe novo--Yuen2017 G
DLG2     1-0200-004chr11:
83398672-83398672
GAintronicDe novo--Yuen2017 G
DLG2     AU1909304chr11:
84613875-84613875
CTintronicDe novo--Yuen2017 G
DLG2     2-1129-003chr11:
84044029-84044029
TCintronicDe novo--Yuen2016 G
Yuen2017 G
DLG2     5-0073-003chr11:
84932589-84932589
TCintronicDe novo--Yuen2017 G
DLG2     5-0131-003chr11:
85324902-85324902
GAintronicDe novo--Yuen2017 G
DLG2     1-0214-003chr11:
83664589-83664589
GAintronicDe novo--Yuen2017 G
DLG2     AU1909304chr11:
84613842-84613842
CAintronicDe novo--Yuen2017 G
DLG2     2-1429-003chr11:
83240831-83240831
AGintronicDe novo--Yuen2017 G
DLG2     2-0019-004chr11:
85258144-85258144
GAintronicDe novo--Yuen2017 G
DLG2     AU2292301chr11:
85183624-85183624
GCintronicDe novo--Yuen2017 G
DLG2     12498.p1chr11:
83641706-83641706
CTintronicDe novo--Turner2016 G
DLG2     2-1381-003chr11:
84176800-84176800
CTintronicDe novo--Yuen2017 G
DLG2     1-0777-003chr11:
85311117-85311117
TCintronicDe novo--Yuen2017 G
DLG2     13964.p1chr11:
85072527-85072527
AGintronicDe novo--Turner2016 G
DLG2     2-0319-004chr11:
84879650-84879650
GAintronicDe novo--Yuen2017 G
DLG2     14015.p1chr11:
83879010-83879010
AGintronicDe novo--Turner2016 G
DLG2     12498.p1chr11:
84276318-84276318
AGintronicDe novo--Turner2016 G
DLG2     2-1116-003chr11:
84439301-84439301
CTintronicDe novo--Yuen2016 G
DLG2     2-1350-004chr11:
85109182-85109182
ATintronicDe novo--Yuen2017 G
DLG2     7-0219-003chr11:
83924637-83924637
TCintronicDe novo--Yuen2017 G
DLG2     1-0874-003chr11:
84941531-84941531
GAintronicDe novo--Yuen2017 G
DLG2     AU076705chr11:
84536579-84536579
TCintronicDe novo--Yuen2017 G
DLG2     2-0143-004chr11:
85114995-85114995
GTintronicDe novo--Yuen2017 G
DLG2     AU012803chr11:
84364239-84364239
CAintronicDe novo--Yuen2017 G
DLG2     2-1329-003chr11:
85281756-85281756
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DLG2     NDAR_INVZY951KXU_wes1chr11:
83497765-83497765
GCexonicDe novononsynonymous SNVNM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.C1169G
c.C1595G
c.C1478G
c.C1478G
c.C1793G
p.T390R
p.T532R
p.T493R
p.T493R
p.T598R
20.3-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
DLG2     1-0744-003chr11:
84363445-84363445
GAintronicDe novo--Yuen2017 G
DLG2     2-1329-003chr11:
85280906-85280906
CGintronicDe novo--Yuen2016 G
Yuen2017 G
DLG2     AU009805chr11:
83269850-83269850
GTintronicDe novo--Yuen2017 G
DLG2     AU4145303chr11:
83447775-83447789
TAAGAAGAAGAAGAATAAGAAGAAGAAintronicDe novo--Yuen2017 G
DLG2     2-1362-003chr11:
83370757-83370757
CTintronicDe novo--Yuen2017 G
DLG2     1-0259-005chr11:
83585188-83585188
GCintronicDe novo--Yuen2017 G
DLG2     2-0126-004chr11:
84866394-84866394
TGintronicDe novo--Yuen2017 G
DLG2     2-1730-003chr11:
83299469-83299469
CGintronicDe novo--Yuen2017 G
DLG2     2-0318-003chr11:
83499201-83499201
TCintronicDe novo--Yuen2017 G
DLG2     212-21026-1chr11:
84027990-84027991
ACGexonicInheritedframeshift substitutionNM_001206769c.198_199CN/A--Stessman2017 T
DLG2     08C74959chr11:
83362858-83362858
GAintronicDe novo--Satterstrom2020 E
DLG2     AU3636302chr11:
85176824-85176824
CAintronicDe novo--Yuen2017 G
DLG2     2-1264-003chr11:
85035956-85035956
TCintronicDe novo--Yuen2017 G
DLG2     1-0534-003chr11:
84489628-84489628
GAintronicDe novo--Yuen2017 G
DLG2     5-0148-003chr11:
84021062-84021062
GAintronicDe novo--Yuen2017 G
DLG2     A2chr11:
84882964-84882964
AGintronicDe novo--Wu2018 G
DLG2     AU2075302chr11:
83939378-83939378
GCintronicDe novo--Yuen2017 G
DLG2     AU2292302chr11:
85183624-85183624
GCintronicDe novo--Yuen2017 G
DLG2     M30940chr11:
83173084-83173084
CTexonicMaternalnonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G859A
c.G2104A
c.G2584A
c.G2413A
c.G2467A
c.G2782A
p.A287T
p.A702T
p.A862T
p.A805T
p.A823T
p.A928T
34.08.288E-6Guo2018 T
DLG2     1-0353-003chr11:
84768497-84768497
TCintronicDe novo--Yuen2017 G
DLG2     1-0184-003chr11:
85214979-85215000
AAGGAGGAGGAGGAGGAGGAGGAAGGAGGAGGAGGAGGAGGintronicDe novo--Yuen2017 G
DLG2     G6U8Schr11:
83252891-83252891
CTexonicInheritednonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G82A
c.G1327A
c.G1753A
c.G1636A
c.G1636A
c.G1951A
p.D28N
p.D443N
p.D585N
p.D546N
p.D546N
p.D651N
35.01.713E-5Stessman2017 T
DLG2     M30856chr11:
83182725-83182725
CTexonicMaternalnonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G467A
c.G1712A
c.G2192A
c.G2021A
c.G2075A
c.G2390A
p.R156Q
p.R571Q
p.R731Q
p.R674Q
p.R692Q
p.R797Q
34.04.183E-5Guo2018 T
DLG2     AU2156303chr11:
84612535-84612535
CAintronicDe novo--Yuen2017 G
DLG2     2-0102-004chr11:
84761521-84761521
GAintronicDe novo--Yuen2017 G
DLG2     2-1359-003chr11:
83545343-83545343
AGintronicDe novo--Yuen2017 G
DLG2     AU3634301chr11:
84245862-84245862
TAintronicDe novo--Yuen2017 G
DLG2     AU2000304chr11:
84363440-84363440
GTintronicDe novo--Yuen2017 G
DLG2     AU038703chr11:
84028234-84028234
AGUTR5De novo--Yuen2017 G
DLG2     HN0054.p1chr11:
83770385-83770385
CTexonicUnknownnonsynonymous SNVNM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G424A
c.G694A
c.G577A
c.G577A
c.G892A
p.E142K
p.E232K
p.E193K
p.E193K
p.E298K
33.01.658E-5Guo2018 T
DLG2     1-0564-003chr11:
83542504-83542504
GAintronicDe novo--Yuen2017 G
DLG2     AU2525302chr11:
83441440-83441440
TCintronicDe novo--Yuen2017 G
DLG2     7-0024-003chr11:
83765813-83765813
CTintronicDe novo--Yuen2017 G
DLG2     1-0336-004chr11:
85312933-85312933
GAintronicDe novo--Yuen2017 G
DLG2     2-0320-003chr11:
83633592-83633593
AGAGGintronicDe novo--Yuen2017 G
DLG2     1-0572-003chr11:
85301022-85301022
ACintronicDe novo--Yuen2017 G
DLG2     03C16606chr11:
83195273-83195275
TGTTintronicMaternal--Stessman2017 T
DLG2     1-0059-003chr11:
83450524-83450524
AATATTintronicDe novo--Yuen2017 G
DLG2     AU066403chr11:
85136902-85136902
CTintronicDe novo--Yuen2017 G
DLG2     2-0145-004chr11:
83199043-83199043
GAintronicDe novo--Yuen2017 G
DLG2     AU058103chr11:
84273427-84273427
AGintronicDe novo--Yuen2017 G
DLG2     1-0706-003chr11:
84048017-84048018
ATATTTintronicDe novo--Yuen2017 G
DLG2     1-0173-004chr11:
84662180-84662180
TCintronicDe novo--Yuen2017 G
DLG2     2-1146-003chr11:
84620706-84620706
AGintronicDe novo--Yuen2017 G
DLG2     AU4310301chr11:
83559166-83559166
CTintronicDe novo--Yuen2017 G
DLG2     AU4344301chr11:
85320061-85320061
TCintronicDe novo--Yuen2017 G
DLG2     2-1146-003chr11:
84914697-84914697
AGintronicDe novo--Yuen2017 G
DLG2     GX0245.p1chr11:
83344300-83344300
CTexonicPaternalnonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G25A
c.G1270A
c.G1696A
c.G1579A
c.G1579A
c.G1894A
p.G9R
p.G424R
p.G566R
p.G527R
p.G527R
p.G632R
36.08.303E-6Guo2018 T
DLG2     AU1698301chr11:
84268620-84268620
TCintronicDe novo--Yuen2017 G
DLG2     AU2137304chr11:
83316662-83316662
GAintronicDe novo--Yuen2017 G
DLG2     2-1341-004chr11:
83252678-83252678
GTintronicDe novo-8.907E-6Yuen2017 G
DLG2     1-0206-005chr11:
85224852-85224852
CAintronicDe novo--Yuen2017 G
DLG2     1-0257-003chr11:
84106240-84106240
CTintronicDe novo--Yuen2017 G
DLG2     AU3801301chr11:
83461330-83461330
CGintronicDe novo--Yuen2017 G
DLG2     M21586chr11:
83344359-83344359
CTexonicMaternalnonsynonymous SNVNM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G1211A
c.G1637A
c.G1520A
c.G1520A
c.G1835A
p.R404Q
p.R546Q
p.R507Q
p.R507Q
p.R612Q
34.0-Guo2018 T
Wang2016 T
DLG2     2-1305-003chr11:
83180643-83180643
GCintronicDe novo--Yuen2016 G
Yuen2017 G
DLG2     M12341chr11:
84996284-84996284
TAexonicPaternalstopgainNM_001142699c.A166Tp.R56X13.59-Guo2018 T
Stessman2017 T
Wang2016 T
DLG2     1-0458-003chr11:
85109182-85109182
ATintronicDe novo--Yuen2017 G
DLG2     1-0032-003chr11:
84755768-84755768
CGintronicDe novo--Yuen2017 G
DLG2     2-1322-003chr11:
84052495-84052495
CGintronicDe novo--Yuen2017 G
DLG2     2-1322-003chr11:
83305677-83305677
TAintronicDe novo--Yuen2017 G
DLG2     2-0109-003chr11:
85027530-85027530
AGintronicDe novo--Yuen2017 G
DLG2     2-1629-003chr11:
84330122-84330122
CTintronicDe novo--Yuen2017 G
DLG2     1-0555-003chr11:
84138819-84138819
TCintronicDe novo--Yuen2017 G
DLG2     AU079605chr11:
83460736-83460736
GAintronicDe novo--Yuen2017 G
DLG2     1-0186-004chr11:
83378694-83378694
GCintronicDe novo--Yuen2017 G
DLG2     1-0201-005chr11:
84372880-84372880
ATintronicDe novo--Yuen2017 G
DLG2     5-0123-003chr11:
84203555-84203555
TAintronicDe novo--Yuen2017 G
DLG2     AU038203chr11:
85082278-85082278
TCintronicDe novo--Yuen2017 G
DLG2     2-1215-003chr11:
84194425-84194425
GCintronicDe novo--Yuen2017 G
DLG2     AU4394302chr11:
84718603-84718603
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More