or
or
Exact

Results for "COL4A3BP"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
COL4A3BP     AU116Achr5:
74675192-74675192
TCexonicDe novosynonymous SNVNM_031361
NM_005713
NM_001130105
c.A1776G
c.A1854G
c.A2238G
p.A592A
p.A618A
p.A746A
9.815-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
COL4A3BP     DEASD_0027_001chr5:
74721237-74721237
AGexonicDe novononsynonymous SNVNM_005713
NM_031361
NM_001130105
c.T544C
c.T544C
c.T928C
p.F182L
p.F182L
p.F310L
18.54-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
COL4A3BP     2-1348-003chr5:
74711200-74711200
GAintronicDe novo--Yuen2017 G
COL4A3BP     2-1166-003chr5:
74748698-74748698
AGintronicDe novo--Yuen2017 G
COL4A3BP     SSC12779chr5:
74721285-74721285
TCexonicDe novononsynonymous SNVNM_005713
NM_031361
NM_001130105
c.A496G
c.A496G
c.A880G
p.T166A
p.T166A
p.T294A
19.53-Lim2017 E
COL4A3BP     AU3712302chr5:
74708923-74708923
AGintronicDe novo--Yuen2017 G
COL4A3BP     JASD_Fam0207chr5:
74801861-74801861
ACexonicDe novononsynonymous SNVNM_005713
NM_031361
NM_001130105
c.T177G
c.T177G
c.T561G
p.D59E
p.D59E
p.D187E
11.95-Takata2018 E
COL4A3BP     74-0688chr5:
74793290-74793290
TCintronicDe novo--Michaelson2012 G
COL4A3BP     2-1454-003chr5:
74770568-74770568
ATintronicDe novo--Yuen2017 G
COL4A3BP     14679.p1chr5:
74721285-74721285
TCexonicDe novononsynonymous SNVNM_005713
NM_031361
NM_001130105
c.A496G
c.A496G
c.A880G
p.T166A
p.T166A
p.T294A
19.53-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
COL4A3BP     AU4233301chr5:
74688712-74688712
GAintronicDe novo--Yuen2017 G
COL4A3BP     AU012803chr5:
74699897-74699897
TCintronicDe novo--Yuen2017 G
COL4A3BP     M17640chr5:
74721309-74721309
GAexonicPaternal, Unknownnonsynonymous SNVNM_005713
NM_031361
NM_001130105
c.C472T
c.C472T
c.C856T
p.R158C
p.R158C
p.R286C
34.0-Guo2018 T
Stessman2017 T
Wang2016 T
COL4A3BP     AU4060306chr5:
74668177-74668177
AGUTR3De novo--Yuen2017 G
COL4A3BP     381119chr5:
74712795-74712795
AGexonicUnknownnonsynonymous SNVNM_005713
NM_031361
NM_001130105
c.T743C
c.T743C
c.T1127C
p.F248S
p.F248S
p.F376S
28.5-Stessman2017 T
COL4A3BP     AU4306302chr5:
74722910-74722910
CTintronicDe novo--Yuen2017 G
COL4A3BP     Mahjani2021:14chr5:
74722248-74722248
GTexonicnonsynonymous SNVNM_005713
NM_031361
NM_001130105
c.C404A
c.C404A
c.C788A
p.S135Y
p.S135Y
p.S263Y
29.6-Mahjani2021 E
COL4A3BP     1-0763-003chr5:
74776661-74776661
GAintronicDe novo--Yuen2017 G
COL4A3BP     AU4079302chr5:
74713178-74713178
ACintronicDe novo--Yuen2017 G
COL4A3BP     AU3760301chr5:
74712145-74712150
TAACAATAAintronicDe novo--Yuen2017 G
COL4A3BP     2-1251-003chr5:
74792161-74792187
AATGCCAAGCAAATGGAATTTTCACATAATintronicDe novo--Yuen2017 G
COL4A3BP     1-0383-003chr5:
74725027-74725027
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More