or
or
Exact

Results for "PLXNA4"

Variant Events: 30

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PLXNA4     1-0257-003chr7:
131980419-131980419
GAintronicDe novo--Yuen2017 G
PLXNA4     12636.p1chr7:
131825445-131825445
GAexonicMosaicnonsynonymous SNVNM_020911c.C5351Tp.T1784M25.28.237E-6Krupp2017 E
PLXNA4     1-0269-003chr7:
132320233-132320233
AGintronicDe novo--Yuen2017 G
PLXNA4     1-0323-003chr7:
132183915-132183915
ACintronicDe novo--Yuen2017 G
PLXNA4     1-0153-004chr7:
132239281-132239281
GAintronicDe novo--Yuen2017 G
PLXNA4     1-0971-003chr7:
132151537-132151537
TAintronicDe novo--Yuen2017 G
PLXNA4     1-0496-003chr7:
132321577-132321577
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PLXNA4     AU1860301chr7:
131820824-131820824
AGintronicDe novo--Yuen2017 G
PLXNA4     2-1511-003chr7:
132314970-132314970
AGintronicDe novo--Yuen2017 G
PLXNA4     AU070703chr7:
132323997-132323997
CAintronicDe novo--Yuen2017 G
PLXNA4     3-0661-000chr7:
131918977-131918977
TGintronicDe novo--Yuen2017 G
PLXNA4     AU3451301chr7:
132315118-132315118
CAintronicDe novo--Yuen2017 G
PLXNA4     AU024607chr7:
131846092-131846092
GAintronicDe novo--Yuen2017 G
PLXNA4     AU3124302chr7:
132249967-132249967
GAintronicDe novo--Yuen2017 G
PLXNA4     2-1137-003chr7:
131958101-131958116
GCACACACACACACACGCACACACACACACintronicDe novo--Yuen2017 G
PLXNA4     AU069603chr7:
131917599-131917599
GAintronicDe novo--Yuen2017 G
PLXNA4     11726.p1chr7:
132094142-132094142
CGintronicDe novo--Werling2018 G
PLXNA4     2-0320-003chr7:
132262538-132262538
CTintronicDe novo--Yuen2017 G
PLXNA4     2-1339-003chr7:
132292557-132292557
AACTATCACCATCACTGCCATCATCCintronicDe novo--Yuen2017 G
PLXNA4     1-0218-003chr7:
132272616-132272616
ACintronicDe novo--Yuen2017 G
PLXNA4     1-0099-003chr7:
131928988-131928988
CTintronicDe novo--Yuen2017 G
PLXNA4     1-0226-005chr7:
132193311-132193311
CTexonicDe novononsynonymous SNVNM_001105543
NM_020911
NM_181775
c.G142A
c.G142A
c.G142A
p.A48T
p.A48T
p.A48T
0.0084.0E-4Yuen2017 G
PLXNA4     2-1330-003chr7:
132272100-132272100
CAintronicDe novo--Yuen2016 G
PLXNA4     1-0569-003chr7:
132105934-132105934
ACintronicDe novo--Yuen2017 G
PLXNA4     2-1456-004chr7:
132250395-132250395
GAintronicDe novo--Yuen2017 G
PLXNA4     1-0559-003chr7:
131981346-131981346
CTintronicDe novo--Yuen2017 G
PLXNA4     2-1417-003chr7:
131849252-131849252
GTintronicDe novo--Yuen2017 G
PLXNA4     5-0065-003chr7:
132172337-132172337
GAintronicDe novo--Yuen2017 G
PLXNA4     2-1335-003chr7:
132030801-132030801
ACintronicDe novo--Yuen2017 G
PLXNA4     2-1255-003chr7:
131880391-131880397
GAAAAAAGAAAAAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More