or
or
Exact

Results for "SEMA5A"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SEMA5A     AU003406chr5:
9218169-9218169
CTintronicDe novo--Yuen2017 G
SEMA5A     2-1429-003chr5:
9361856-9361856
GAintronicDe novo--Yuen2017 G
SEMA5A     2-1521-003chr5:
9070281-9070281
GAintronicDe novo--Yuen2017 G
SEMA5A     PN400590chr5:
9202106-9202106
GAexonicDe novononsynonymous SNVNM_003966c.C893Tp.P298L33.0-Leblond2019 E
SEMA5A     2-1361-003chr5:
9104224-9104224
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SEMA5A     3-0391-000chr5:
9463792-9463792
TCintronicDe novo--Yuen2017 G
SEMA5A     1-0112-003chr5:
9438071-9438071
ACintronicDe novo--Yuen2017 G
SEMA5A     AU0638302chr5:
9143786-9143786
GAintronicDe novo--Yuen2017 G
SEMA5A     2-1487-003chr5:
9128310-9128310
GAintronicDe novo--Yuen2017 G
SEMA5A     AU2035301chr5:
9498755-9498755
CTintronicDe novo--Yuen2017 G
SEMA5A     13698.p1chr5:
9043132-9043132
GGAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
SEMA5A     14006.p1chr5:
9050563-9050563
GCexonicDe novononsynonymous SNVNM_003966c.C2852Gp.S951C19.93-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
SEMA5A     14011.p1chr5:
9119084-9119095
GTGCTGGCAGCAGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
SEMA5A     11556.p1chr5:
9274183-9274183
CTintronicDe novo--Werling2018 G
SEMA5A     PN400359chr5:
9190451-9190451
GAexonicUnknownnonsynonymous SNVNM_003966c.C1201Tp.R401C25.91.0E-4Leblond2019 E
SEMA5A     AU4452302chr5:
9442876-9442876
AGintronicDe novo--Yuen2017 G
SEMA5A     AU0540301chr5:
9229232-9229232
CGintronicDe novo--Yuen2017 G
SEMA5A     AU1542301chr5:
9189318-9189318
GAintronicDe novo--Yuen2017 G
SEMA5A     D’Gama2015:1349chr5:
9224846-9224846
GAexonicUnknownstopgainNM_003966c.C586Tp.R196X28.68.25E-6D’Gama2015 T
SEMA5A     2-1735-003chr5:
9084700-9084700
TCintronicDe novo--Yuen2017 G
SEMA5A     2-1380-003chr5:
9454469-9454469
CAintronicDe novo--Yuen2016 G
Yuen2017 G
SEMA5A     AU4007301chr5:
9131747-9131771
AAAAAAAAAAAAAAAAAAAAAAAACAintronicDe novo--Yuen2017 G
SEMA5A     1-0559-003chr5:
9165146-9165146
ACintronicDe novo--Yuen2017 G
SEMA5A     2-1567-004chr5:
9324771-9324771
AGintronicDe novo--Yuen2017 G
SEMA5A     iHART1624chr5:
9066729-9066729
ATexonicDe novostopgainNM_003966c.T2103Ap.C701X45.0-Ruzzo2019 G
SEMA5A     5-0014-003chr5:
9303946-9303946
TCintronicDe novo--Yuen2017 G
SEMA5A     AU1668302chr5:
9212478-9212478
CAintronicDe novo--Yuen2017 G
SEMA5A     7-0168-003chr5:
9172485-9172485
GAintronicDe novo--Yuen2017 G
SEMA5A     1-0936-003chr5:
9343548-9343548
AGintronicDe novo--Yuen2017 G
SEMA5A     1-0936-003chr5:
9068377-9068382
GAGAAGGAGAAGAAGintronicDe novo--Yuen2017 G
SEMA5A     AU4122301chr5:
9080321-9080321
TCintronicDe novo--Yuen2017 G
SEMA5A     AU0452304chr5:
9324470-9324470
GAintronicDe novo--Yuen2017 G
SEMA5A     2-1280-003chr5:
9044891-9044912
GATTATTATTATTATTATTATTGATTATTATTATTATTATTintronicDe novo--Yuen2017 G
SEMA5A     AU2035302chr5:
9498755-9498755
CTintronicDe novo--Yuen2017 G
SEMA5A     PN400194chr5:
9119120-9119120
GAexonicUnknownnonsynonymous SNVNM_003966c.C1915Tp.R639C26.8-Leblond2019 E
SEMA5A     PN400128chr5:
9119120-9119120
GAexonicUnknownnonsynonymous SNVNM_003966c.C1915Tp.R639C26.8-Leblond2019 E
SEMA5A     AU015903chr5:
9210689-9210689
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More