or
or
Exact

Results for "KCNIP4"

Variant Events: 82

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KCNIP4     1-0668-003chr4:
22204488-22204499
CTAGTTAGTTAGCTAGTTAGintergenicDe novo--Yuen2017 G
KCNIP4     160573chr4:
21764594-21764594
TCUTR5De novo--Satterstrom2020 E
KCNIP4     7-0192-003chr4:
21567406-21567406
GCintronicDe novo--Yuen2017 G
KCNIP4     2-0129-004chr4:
21355316-21355316
AGintronicDe novo--Yuen2017 G
KCNIP4     AU4072303chr4:
22130372-22130372
GAintergenicDe novo--Yuen2017 G
KCNIP4     AU018010chr4:
21279043-21279043
TAintronicDe novo--Yuen2017 G
KCNIP4     AU034904chr4:
20815841-20815841
CTintronicDe novo--Yuen2017 G
KCNIP4     2-0129-004chr4:
21962161-21962161
TCintergenicDe novo--Yuen2017 G
KCNIP4     1-0804-003chr4:
21430757-21430757
CTintronicDe novo--Yuen2017 G
KCNIP4     1-0190-003chr4:
21551877-21551877
AGintronicDe novo--Yuen2017 G
KCNIP4     7-0023-003chr4:
22141228-22141229
GTGTATintergenicDe novo--Yuen2017 G
KCNIP4     2-1366-004chr4:
21756518-21756518
CTintronicDe novo--Yuen2017 G
KCNIP4     2-1296-003chr4:
21268839-21268839
CTintronicDe novo--Yuen2017 G
KCNIP4     AU4154303chr4:
20738839-20738839
GTintronicDe novo--Yuen2017 G
KCNIP4     2-1502-003chr4:
22267877-22267877
TCintergenicDe novo--Yuen2017 G
KCNIP4     2-0320-003chr4:
20966243-20966243
TCintronicDe novo--Yuen2017 G
KCNIP4     AU3760302chr4:
20737916-20737916
AGintronicDe novo--Yuen2017 G
KCNIP4     2-0003-004chr4:
22320706-22320706
AGintergenicDe novo--Yuen2017 G
KCNIP4     AU049304chr4:
21375958-21375958
AGintronicDe novo--Yuen2017 G
KCNIP4     AU071204chr4:
21140403-21140403
GAintronicDe novo--Yuen2017 G
KCNIP4     7-0253-003chr4:
21458809-21458809
ATintronicDe novo--Yuen2017 G
KCNIP4     AU1668302chr4:
21049899-21049899
CTintronicDe novo--Yuen2017 G
KCNIP4     AU071804chr4:
21703193-21703193
CAintronicDe novo--Yuen2017 G
KCNIP4     1-0155-003chr4:
21337604-21337604
CGintronicDe novo--Yuen2017 G
KCNIP4     AU071804chr4:
21703197-21703197
TAintronicDe novo--Yuen2017 G
KCNIP4     7-0191-003chr4:
21571493-21571493
ATintronicDe novo--Yuen2017 G
KCNIP4     AU3721301chr4:
21235858-21235858
AGintronicDe novo--Yuen2017 G
KCNIP4     AU050604chr4:
21371157-21371157
CTintronicDe novo--Yuen2017 G
KCNIP4     5-0095-003chr4:
21782528-21782528
TGintronicDe novo--Yuen2017 G
KCNIP4     11057.p1chr4:
21079014-21079014
TTAintronicDe novo--Werling2018 G
KCNIP4     12929.p1chr4:
21461725-21461726
CGCintronicPaternal--Wilfert2021 G
KCNIP4     1-0273-004chr4:
21486377-21486377
CAintronicDe novo--Yuen2017 G
KCNIP4     AU4032307chr4:
21032177-21032177
GAintronicDe novo--Yuen2017 G
KCNIP4     AU3913303chr4:
22180132-22180132
TAintergenicDe novo--Yuen2017 G
KCNIP4     1-0936-003chr4:
21489369-21489369
TAintronicDe novo--Yuen2017 G
KCNIP4     AU059903chr4:
20791410-20791410
CTintronicDe novo--Yuen2017 G
KCNIP4     AU2495302chr4:
20964289-20964289
TCintronicDe novo--Yuen2017 G
KCNIP4     2-1265-003chr4:
21938213-21938213
CTintronicDe novo--Yuen2016 G
Yuen2017 G
KCNIP4     AU031204chr4:
20956100-20956100
CTintronicDe novo--Yuen2017 G
KCNIP4     2-0022-005chr4:
20770092-20770092
TAintronicDe novo--Yuen2017 G
KCNIP4     1-0044-003chr4:
20760948-20760948
CTintronicDe novo--Yuen2017 G
KCNIP4     1-0332-003chr4:
21714027-21714027
GAintronicDe novo--Yuen2017 G
KCNIP4     1-0896-003chr4:
21505806-21505806
ATintronicDe novo--Yuen2017 G
KCNIP4     11572.p1chr4:
20860973-20860973
AGintronicDe novo--Turner2016 G
KCNIP4     AU4260303chr4:
21556362-21556362
GAintronicDe novo--Yuen2017 G
KCNIP4     1-0585-003chr4:
22306211-22306211
CTintergenicDe novo--Yuen2017 G
KCNIP4     AU4426303chr4:
21521121-21521126
ATGTGTATintronicDe novo--Yuen2017 G
KCNIP4     13515.p1chr4:
20883781-20883781
TCintronicDe novo--Turner2016 G
KCNIP4     2-1093-003chr4:
21318815-21318815
CTintronicDe novo--Yuen2017 G
KCNIP4     AU4060306chr4:
21492927-21492927
CGintronicDe novo--Yuen2017 G
KCNIP4     AU1860302chr4:
22062057-22062057
CTintergenicDe novo--Yuen2017 G
KCNIP4     AU3761301chr4:
21218231-21218231
TCintronicDe novo--Yuen2017 G
KCNIP4     1-0175-004chr4:
20818332-20818332
TCintronicDe novo--Yuen2017 G
KCNIP4     AU4392301chr4:
20871384-20871384
GAintronicDe novo--Yuen2017 G
KCNIP4     AU3371305chr4:
22101988-22101988
CAintergenicDe novo--Yuen2017 G
KCNIP4     AU4392301chr4:
21227730-21227730
GAintronicDe novo--Yuen2017 G
KCNIP4     2-1094-004chr4:
22276448-22276448
GCintergenicDe novo--Yuen2017 G
KCNIP4     2-0295-004chr4:
21792057-21792057
ATintronicMaternal--Yuen2017 G
KCNIP4     5-0116-003chr4:
21465955-21465955
TCintronicDe novo--Yuen2017 G
KCNIP4     5-0116-003chr4:
21923356-21923356
GCintronicDe novo--Yuen2017 G
KCNIP4     1-0487-003chr4:
20836937-20836937
TCintronicDe novo--Yuen2016 G
KCNIP4     AU011604chr4:
21062220-21062220
CTintronicDe novo--Yuen2017 G
KCNIP4     3-0065-000chr4:
21155071-21155089
CCTCTCTCTCTCTCTCTCTCCTCTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
KCNIP4     AU031404chr4:
21567464-21567466
ACCACintronicDe novo--Yuen2017 G
KCNIP4     1-0744-003chr4:
22101624-22101624
CTintergenicDe novo--Yuen2017 G
KCNIP4     AU072005chr4:
21496577-21496577
CTintronicDe novo--Yuen2017 G
KCNIP4     AU2756306chr4:
21470868-21470868
CTintronicDe novo--Yuen2017 G
KCNIP4     AU4306302chr4:
21257832-21257832
GAintronicDe novo--Yuen2017 G
KCNIP4     2-0272-003chr4:
21234341-21234341
GAintronicDe novo--Yuen2017 G
KCNIP4     1-0175-003chr4:
20818332-20818332
TCintronicDe novo--Yuen2017 G
KCNIP4     1-0290-003chr4:
21945267-21945267
GAintronicDe novo--Yuen2017 G
KCNIP4     AU4235303chr4:
22021915-22021915
CAintergenicDe novo--Yuen2017 G
KCNIP4     5-0045-003chr4:
22077969-22077969
TCintergenicDe novo--Yuen2017 G
KCNIP4     AU066404chr4:
21824226-21824226
AGintronicDe novo--Yuen2017 G
KCNIP4     2-1391-004chr4:
21588384-21588384
ATintronicDe novo--Yuen2017 G
KCNIP4     2-1391-004chr4:
20847974-20847974
TAintronicDe novo--Yuen2017 G
KCNIP4     2-1277-004chr4:
21915106-21915106
CAintronicDe novo--Yuen2017 G
KCNIP4     1-0736-003chr4:
21836920-21836920
TAintronicDe novo--Yuen2017 G
KCNIP4     1-0126-003chr4:
21444273-21444273
AGintronicDe novo--Yuen2017 G
KCNIP4     2-0295-003chr4:
21792057-21792057
ATintronicMaternal--Yuen2017 G
KCNIP4     1-0412-003chr4:
21297523-21297523
TCintronicDe novo--Yuen2017 G
KCNIP4     5-0140-003chr4:
21293176-21293176
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More