or
or
Exact

Results for "IRX3"

Variant Events: 32

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IRX3     2-1345-003chr16:
54572547-54572547
TCintergenicDe novo--Yuen2017 G
IRX3     2-1105-003chr16:
54462959-54462975
GGAGAGAGAGAGAGAGAGGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
IRX3     AU3900302chr16:
54652398-54652398
TCintergenicDe novo--Yuen2017 G
IRX3     AU1933301chr16:
54387576-54387576
AGintergenicDe novo--Yuen2017 G
IRX3     AU2458303chr16:
54402823-54402823
GTintergenicDe novo--Yuen2017 G
IRX3     AU3881301chr16:
54722463-54722463
AGintergenicDe novo--Yuen2017 G
IRX3     iHART3050chr16:
54319888-54319901
GCCGCCAGCGGCCCGexonicUnknownframeshift deletionNM_024336c.62_74delp.G21fs--Ruzzo2019 G
IRX3     7-0253-003chr16:
54786465-54786482
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
IRX3     AU0540301chr16:
54554405-54554405
CTintergenicDe novo--Yuen2017 G
IRX3     2-0318-004chr16:
54772532-54772532
AGintergenicDe novo--Yuen2017 G
IRX3     1-0300-003chr16:
54799007-54799007
AGintergenicDe novo--Yuen2017 G
IRX3     2-1620-004chr16:
54641203-54641203
TCintergenicDe novo--Yuen2017 G
IRX3     AU3302302chr16:
54500522-54500522
TCintergenicDe novo--Yuen2017 G
IRX3     2-1440-003chr16:
54802933-54802933
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
IRX3     1-0191-003chr16:
54517139-54517139
CTintergenicDe novo--Yuen2017 G
IRX3     3-0065-000chr16:
54873336-54873336
GAintergenicDe novo--Yuen2017 G
IRX3     2-1255-003chr16:
54923136-54923136
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
IRX3     5-0077-003chr16:
54914133-54914133
GAintergenicDe novo--Yuen2017 G
IRX3     AU3761302chr16:
54431806-54431806
TCintergenicDe novo--Yuen2017 G
IRX3     AU1640302chr16:
54805091-54805091
TCintergenicDe novo--Yuen2017 G
IRX3     5-0114-003chr16:
54515736-54515736
TCintergenicDe novo--Yuen2017 G
IRX3     AU3702307chr16:
54410696-54410696
GAintergenicDe novo--Yuen2017 G
IRX3     5-0095-003chr16:
54890545-54890545
TAintergenicDe novo--Yuen2017 G
IRX3     AU4092302chr16:
54823150-54823150
GAintergenicDe novo--Yuen2017 G
IRX3     AU065807chr16:
54505181-54505181
AGintergenicDe novo--Yuen2017 G
IRX3     12011.p1chr16:
54488393-54488393
ATintergenicDe novo--Turner2016 G
IRX3     2-0244-003chr16:
54788915-54788915
ATintergenicDe novo--Yuen2017 G
IRX3     2-1441-003chr16:
54854971-54854971
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
IRX3     13324.p1chr16:
54638019-54638019
TCintergenicDe novo--Turner2016 G
IRX3     AU3680302chr16:
54903215-54903215
ATintergenicDe novo--Yuen2017 G
IRX3     AU071703chr16:
54667694-54667694
TAintergenicDe novo--Yuen2017 G
IRX3     13403.p1chr16:
54771075-54771075
CTintergenicUnknown--Werling2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More