or
or
Exact

Results for "GCFC2"

Variant Events: 62

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GCFC2     AU008505chr2:
76828494-76828494
CTintergenicDe novo--Yuen2017 G
GCFC2     AU034904chr2:
76493028-76493028
TCintergenicDe novo--Yuen2017 G
GCFC2     2-0003-004chr2:
76305570-76305570
GAintergenicDe novo--Yuen2017 G
GCFC2     1-0590-003chr2:
76813497-76813497
CGintergenicDe novo--Yuen2017 G
GCFC2     1-0382-004chr2:
76866660-76866660
TCintergenicDe novo--Yuen2017 G
GCFC2     1-0323-004chr2:
76114164-76114164
AACAAAACintergenicDe novo--Yuen2017 G
GCFC2     2-0323-004chr2:
76593173-76593173
TTTCCintergenicDe novo--Yuen2017 G
GCFC2     2-1155-003chr2:
76060265-76060265
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
GCFC2     1-0458-004chr2:
76593173-76593173
TTTCCintergenicDe novo--Yuen2017 G
GCFC2     1-0563-004chr2:
76071763-76071763
CCTTTTGintergenicDe novo--Yuen2017 G
GCFC2     AU3903302chr2:
76482629-76482629
CTintergenicDe novo--Yuen2017 G
GCFC2     AU2975302chr2:
76558710-76558716
CAAAAAACAAAAAAAintergenicDe novo--Yuen2017 G
GCFC2     2-1302-003chr2:
75942220-75942220
AGintergenicDe novo--Yuen2017 G
GCFC2     2-1645-003chr2:
76932029-76932029
CTintergenicDe novo--Yuen2017 G
GCFC2     2-1721-003chr2:
76822117-76822117
CTintergenicDe novo--Yuen2017 G
GCFC2     1-0382-003chr2:
75912038-75912038
TTGintronicDe novo--Yuen2017 G
GCFC2     2-1398-003chr2:
76324961-76324961
TCintergenicDe novo--Yuen2017 G
GCFC2     1-0465-003chr2:
76579980-76579980
TCintergenicDe novo--Yuen2017 G
GCFC2     1-0162-004chr2:
76204465-76204465
GTintergenicDe novo--Yuen2017 G
GCFC2     3-0391-000chr2:
76453174-76453174
AGintergenicDe novo--Yuen2017 G
GCFC2     1-0469-003chr2:
76076207-76076207
TGintergenicDe novo--Yuen2017 G
GCFC2     11939.p1chr2:
75904421-75904421
TCintronicUnknown--Werling2018 G
GCFC2     2-1370-003chr2:
76709465-76709465
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
GCFC2     2-1066-003chr2:
75912038-75912038
TTGintronicDe novo--Yuen2017 G
GCFC2     AU072505chr2:
76387993-76387993
TGintergenicDe novo--Yuen2017 G
GCFC2     AU4463303chr2:
75966018-75966018
CTintergenicDe novo--Yuen2017 G
GCFC2     AU3190305chr2:
76086580-76086580
TCintergenicDe novo--Yuen2017 G
GCFC2     1-0253-005chr2:
75952598-75952598
GTintergenicDe novo--Yuen2017 G
GCFC2     AU4067301chr2:
76314144-76314147
GTTTGTintergenicDe novo--Yuen2017 G
GCFC2     iHART1128chr2:
75928378-75928382
CCTGACexonicPaternalframeshift deletionNM_001201334
NM_003203
c.144_147del
c.651_654del
p.S48fs
p.S217fs
-2.489E-5Ruzzo2019 G
GCFC2     1-0329-004chr2:
75960650-75960650
CTintergenicDe novo--Yuen2017 G
GCFC2     1-0259-005chr2:
76758252-76758252
GAintergenicDe novo--Yuen2017 G
GCFC2     1-0874-003chr2:
76931984-76931984
TCintergenicDe novo--Yuen2017 G
GCFC2     7-0032-003chr2:
76209196-76209196
GAintergenicDe novo--Yuen2017 G
GCFC2     7-0160-003chr2:
76806966-76806966
AGintergenicDe novo--Yuen2017 G
GCFC2     AU4269301chr2:
76041591-76041591
AGintergenicDe novo--Yuen2017 G
GCFC2     2-1143-003chr2:
76935771-76935771
TCintergenicDe novo--Yuen2017 G
GCFC2     AU3811301chr2:
76698162-76698162
TGintergenicDe novo--Yuen2017 G
GCFC2     5-0065-003chr2:
76006398-76006398
CGintergenicDe novo--Yuen2017 G
GCFC2     7-0097-003chr2:
76715428-76715428
AGintergenicDe novo--Yuen2017 G
GCFC2     AU3729301chr2:
75955972-75955972
GCintergenicDe novo--Yuen2017 G
GCFC2     AU073003chr2:
76299071-76299089
AATAGTAGTGTCTTATAGTAATAGTintergenicDe novo--Yuen2017 G
GCFC2     1-1004-003chr2:
75922884-75922884
CTintronicDe novo--Yuen2017 G
GCFC2     7-0080-003chr2:
76671861-76671861
TCintergenicDe novo--Yuen2017 G
GCFC2     2-0272-003chr2:
76886332-76886332
AGintergenicDe novo--Yuen2017 G
GCFC2     1-0028-003chr2:
76106068-76106068
CTintergenicDe novo--Yuen2017 G
GCFC2     1-0296-004chr2:
76594797-76594797
AGintergenicDe novo--Yuen2017 G
GCFC2     5-0128-003chr2:
76352692-76352692
CAintergenicDe novo--Yuen2017 G
GCFC2     7-0273-003chr2:
76579523-76579523
CTintergenicDe novo--Yuen2017 G
GCFC2     AU3865301chr2:
75940857-75940857
AGintergenicDe novo--Yuen2017 G
GCFC2     1-0512-003chr2:
76930633-76930633
TGintergenicDe novo--Yuen2017 G
GCFC2     7-0256-003chr2:
76901878-76901878
GTintergenicDe novo--Yuen2017 G
GCFC2     13942.p1chr2:
76914418-76914418
TGintergenicDe novo--Turner2016 G
GCFC2     7-0024-003chr2:
76703112-76703112
AGintergenicDe novo--Yuen2017 G
GCFC2     AU3777302chr2:
76045041-76045041
ATintergenicDe novo--Yuen2017 G
GCFC2     2-0264-004chr2:
76243911-76243911
TCintergenicDe novo--Yuen2017 G
GCFC2     7-0249-004chr2:
76457196-76457196
AGintergenicDe novo--Yuen2017 G
GCFC2     1-0329-003chr2:
75960650-75960650
CTintergenicDe novo--Yuen2017 G
GCFC2     1-0465-003achr2:
76579980-76579980
TCintergenicDe novo--Yuen2017 G
GCFC2     1-0572-003chr2:
76067200-76067200
CTintergenicDe novo--Yuen2017 G
GCFC2     AU056005chr2:
76412209-76412209
GAintergenicDe novo--Yuen2017 G
GCFC2     AU3905302chr2:
76556414-76556414
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More