or
or
Exact

Results for "PTPRG"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PTPRG     2-1188-003chr3:
61902054-61902054
AGintronicDe novo--Yuen2017 G
PTPRG     1-0052-004chr3:
62106125-62106125
TTTAAAATAAAAGATTGTATAAAAAAAAAGATTGAAintronicDe novo--Yuen2017 G
PTPRG     AU3713301chr3:
62176267-62176267
CTintronicDe novo--Yuen2017 G
PTPRG     AU3839302chr3:
61729377-61729377
AGintronicDe novo--Yuen2017 G
PTPRG     1-0294-003chr3:
61728401-61728401
GAintronicDe novo--Yuen2016 G
PTPRG     AU4452302chr3:
61696300-61696300
ATintronicDe novo--Yuen2017 G
PTPRG     AU4479301chr3:
62021021-62021021
CGintronicDe novo--Yuen2017 G
PTPRG     AU056804chr3:
61938281-61938281
CTintronicDe novo--Yuen2017 G
PTPRG     2-0320-003chr3:
62125654-62125654
CTintronicDe novo--Yuen2017 G
PTPRG     1-0079-003chr3:
61816769-61816769
CGintronicDe novo--Yuen2017 G
PTPRG     1-0744-003chr3:
61933157-61933157
TCintronicDe novo--Yuen2017 G
PTPRG     AU3861301chr3:
61971830-61971830
GCintronicDe novo--Yuen2017 G
PTPRG     1-0568-003chr3:
61683656-61683656
AGintronicDe novo--Yuen2017 G
PTPRG     1-0568-003chr3:
61682366-61682366
CGintronicDe novo--Yuen2017 G
PTPRG     1-0568-003chr3:
61680927-61680927
CTintronicDe novo--Yuen2017 G
PTPRG     1-0568-003chr3:
61686999-61686999
AGintronicDe novo--Yuen2017 G
PTPRG     14172.p1chr3:
61734741-61734741
TGintronicDe novo8.303-Satterstrom2020 E
PTPRG     2-0182-003chr3:
62173847-62173847
AGintronicDe novo--Yuen2017 G
PTPRG     12738.p1chr3:
61747795-61747795
TCintronicDe novo--Werling2018 G
PTPRG     5-0055-004chr3:
61861592-61861592
CTintronicDe novo--Yuen2017 G
PTPRG     2-1356-003chr3:
62179486-62179486
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRG     AU2756306chr3:
61655423-61655423
TGintronicDe novo--Yuen2017 G
PTPRG     2-1283-003chr3:
62193550-62193550
ATintronicDe novo--Yuen2017 G
PTPRG     2-1402-003chr3:
61967396-61967396
GAintronicDe novo--Yuen2017 G
PTPRG     DEASD_0059_001chr3:
62258653-62258653
TCexonicDe novononsynonymous SNVNM_002841c.T3215Cp.V1072A28.8-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
PTPRG     1-0998-003chr3:
61989047-61989047
AGexonicDe novononsynonymous SNVNM_002841c.A395Gp.Y132C24.22.476E-5Yuen2017 G
PTPRG     2-1511-003chr3:
62000533-62000533
TCintronicDe novo--Yuen2017 G
PTPRG     AU1308303chr3:
61830829-61830830
CACintronicDe novo--Yuen2017 G
PTPRG     1-0272-003chr3:
61983075-61983075
GAintronicDe novo--Yuen2017 G
PTPRG     2-1194-003chr3:
61906554-61906554
CTintronicDe novo--Yuen2017 G
PTPRG     2-1440-003chr3:
62023113-62023113
AGintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRG     AU4347301chr3:
61844950-61844950
AGintronicDe novo--Yuen2017 G
PTPRG     1-0518-003chr3:
61797711-61797711
AGintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRG     AU4476302chr3:
61745706-61745706
AGintronicDe novo--Yuen2017 G
PTPRG     2-1627-003chr3:
61764620-61764630
AGAGGGAGGGAAGAGGGAGGGAGGGAintronicDe novo--Yuen2017 G
PTPRG     1-0049-004chr3:
62073921-62073921
CTintronicDe novo--Yuen2017 G
PTPRG     1-0555-003chr3:
62230202-62230202
CTintronicDe novo--Yuen2017 G
PTPRG     AU2410302chr3:
62033354-62033354
GCintronicDe novo--Yuen2017 G
PTPRG     1-0863-003chr3:
61838448-61838448
CAintronicDe novo--Yuen2017 G
PTPRG     1-0507-003chr3:
61727216-61727216
TGintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRG     2-1283-004chr3:
62193550-62193550
ATintronicDe novo--Yuen2017 G
PTPRG     5-0055-003chr3:
61810280-61810280
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More