or
or
Exact

Results for "LPP"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LPP     1-0112-003chr3:
188172393-188172396
GGAAGintronicDe novo--Yuen2017 G
LPP     1-0986-003chr3:
188491783-188491783
TGintronicDe novo--Yuen2017 G
LPP     2-1626-003chr3:
187936093-187936093
TCintronicDe novo--Yuen2017 G
LPP     1-0465-003achr3:
188635305-188635305
CTintergenicDe novo--Yuen2017 G
LPP     AU4183301chr3:
187884065-187884065
ATintronicDe novo--Yuen2017 G
LPP     2-0142-004chr3:
188387592-188387592
GAintronicDe novo--Yuen2017 G
LPP     AU050910chr3:
187955106-187955106
GTintronicDe novo--Yuen2017 G
LPP     13649.p1chr3:
188390698-188390698
AGintronicDe novo--Turner2016 G
LPP     2-1280-003chr3:
188546359-188546359
CTintronicDe novo--Yuen2016 G
Yuen2017 G
LPP     2-1094-004chr3:
188010329-188010329
GAintronicDe novo--Yuen2017 G
LPP     14370.p1chr3:
187921770-187921770
TCintronicDe novo--Turner2016 G
LPP     1-0539-003chr3:
188522773-188522773
TCintronicDe novo--Yuen2017 G
LPP     AU3760302chr3:
188370774-188370774
AGintronicDe novo--Yuen2017 G
LPP     3-0432-000chr3:
188640955-188640955
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
LPP     AU2108302chr3:
188634282-188634282
CTintergenicDe novo--Yuen2017 G
LPP     A1chr3:
187881835-187881835
TCintronicDe novo--Wu2018 G
LPP     2-1265-003chr3:
187980520-187980533
TCACACACACACACTCACACACACACintronicDe novo--Yuen2017 G
LPP     1-0043-004chr3:
188361542-188361542
CTintronicDe novo--Yuen2017 G
LPP     5-0042-003chr3:
188445987-188445987
CTintronicDe novo--Yuen2017 G
LPP     1-0465-003chr3:
188635305-188635305
CTintergenicDe novo--Yuen2017 G
LPP     2-1633-003chr3:
188271840-188271840
CAintronicDe novo--Yuen2017 G
LPP     AU3782303chr3:
188197785-188197785
GAintronicDe novo--Yuen2017 G
LPP     1-0534-006chr3:
188299194-188299194
GCintronicDe novo--Yuen2017 G
LPP     AU074503chr3:
188375457-188375457
TCintronicDe novo--Yuen2017 G
LPP     AU1223303chr3:
187935972-187935972
GAintronicDe novo--Yuen2017 G
LPP     2-1741-003chr3:
188525516-188525516
TCintronicDe novo--Yuen2017 G
LPP     AU3761302chr3:
188241441-188241445
CTTTTCTTintronicDe novo--Yuen2017 G
LPP     AU058104chr3:
188225205-188225205
CAintronicDe novo--Yuen2017 G
LPP     11954.p1chr3:
188200887-188200887
TAintronicDe novo--Werling2018 G
LPP     2-1521-003chr3:
188026664-188026664
GAintronicDe novo--Yuen2017 G
LPP     AU3885304chr3:
188143828-188143828
CTintronicDe novo--Yuen2017 G
LPP     2-1591-003chr3:
188088321-188088321
CTintronicDe novo--Yuen2017 G
LPP     AU3787302chr3:
188043060-188043060
CTintronicDe novo--Yuen2017 G
LPP     1-0329-003chr3:
188310341-188310341
TTGintronicDe novo--Yuen2017 G
LPP     2-1264-003chr3:
188379255-188379255
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More