or
or
Exact

Results for "SAMD5"

Variant Events: 50

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SAMD5     AU2075302chr6:
148238488-148238488
CGintergenicDe novo--Yuen2017 G
SAMD5     2-0018-004chr6:
147860465-147860465
AGintronicDe novo--Yuen2017 G
SAMD5     1-0006-004chr6:
148275344-148275344
CTintergenicDe novo--Yuen2017 G
SAMD5     11348.p1chr6:
148347885-148347885
TGintergenicDe novo--Werling2018 G
SAMD5     AU043804chr6:
148583478-148583478
TCintergenicDe novo--Yuen2017 G
SAMD5     AU4033303chr6:
148629207-148629207
TCintergenicDe novo--Yuen2017 G
SAMD5     AU4264302chr6:
147891654-147891654
CTdownstreamDe novo--Yuen2017 G
SAMD5     2-0264-004chr6:
147894989-147894989
GAintergenicDe novo--Yuen2017 G
SAMD5     AU3874301chr6:
147965424-147965424
GAintergenicDe novo--Yuen2017 G
SAMD5     1-0336-004chr6:
148389604-148389604
ACintergenicDe novo--Yuen2017 G
SAMD5     2-0242-005chr6:
147915139-147915154
CCTGTAATCCCAGATACintergenicDe novo--Yuen2017 G
SAMD5     5-0106-003chr6:
147854048-147854048
CTintronicDe novo--Yuen2017 G
SAMD5     AU2293302chr6:
148310811-148310811
GAintergenicDe novo--Yuen2017 G
SAMD5     1-0898-003chr6:
148274299-148274299
CTintergenicDe novo--Yuen2017 G
SAMD5     AU1933301chr6:
148036305-148036305
CTintergenicDe novo--Yuen2017 G
SAMD5     1-0169-003chr6:
148274265-148274265
CCTAAintergenicDe novo--Yuen2017 G
SAMD5     AU3721301chr6:
148335874-148335884
TAGACAGACAGTAGACAGintergenicDe novo--Yuen2017 G
SAMD5     1-0181-004chr6:
147887183-147887183
GCUTR3De novo--Yuen2017 G
SAMD5     1-0271-003chr6:
148552811-148552811
CAintergenicDe novo--Yuen2017 G
SAMD5     AU074503chr6:
148489609-148489609
GCintergenicDe novo--Yuen2017 G
SAMD5     2-1279-003chr6:
147937867-147937867
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
SAMD5     2-0242-004chr6:
147915139-147915154
CCTGTAATCCCAGATACintergenicDe novo--Yuen2017 G
SAMD5     AU074503chr6:
148489181-148489181
CTintergenicDe novo--Yuen2017 G
SAMD5     AU3874303chr6:
148341501-148341501
CTintergenicDe novo--Yuen2017 G
SAMD5     2-0116-004chr6:
148294308-148294308
CTintergenicDe novo--Yuen2017 G
SAMD5     2-0102-003chr6:
148416253-148416253
CGintergenicDe novo--Yuen2017 G
SAMD5     2-1131-003chr6:
148515952-148515952
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
SAMD5     1-0656-003chr6:
148408447-148408447
CTintergenicDe novo--Yuen2017 G
SAMD5     AU3903301chr6:
148030630-148030644
TTTTGCTTTGGTTTGTTTTGintergenicDe novo--Yuen2017 G
SAMD5     1-0269-005chr6:
148000770-148000770
AGintergenicDe novo--Yuen2017 G
SAMD5     AU1640302chr6:
148118832-148118832
CTintergenicDe novo--Yuen2017 G
SAMD5     AU015903chr6:
148085359-148085359
AGintergenicDe novo--Yuen2017 G
SAMD5     1-0191-004chr6:
148392381-148392381
ACintergenicDe novo--Yuen2017 G
SAMD5     7-0032-003chr6:
147829052-147829052
GAupstreamDe novo--Yuen2017 G
SAMD5     AU4145303chr6:
148578871-148578871
AGintergenicDe novo--Yuen2017 G
SAMD5     1-0303-004chr6:
148280203-148280203
CTintergenicDe novo--Yuen2017 G
SAMD5     7-0188-003chr6:
148354469-148354469
ATintergenicDe novo--Yuen2017 G
SAMD5     AU3861301chr6:
148375101-148375101
ATintergenicDe novo--Yuen2017 G
SAMD5     1-0559-005chr6:
147915139-147915154
CCTGTAATCCCAGATACintergenicDe novo--Yuen2017 G
SAMD5     1-0232-004chr6:
148644042-148644042
CCTTTintergenicDe novo--Yuen2017 G
SAMD5     1-0414-005chr6:
147843206-147843210
ATCTGAintronicDe novo--Yuen2017 G
SAMD5     AU3768302chr6:
148427778-148427778
GAintergenicDe novo--Yuen2017 G
SAMD5     iHART2049chr6:
147885541-147885541
TTGGCAexonicPaternalframeshift insertionNM_001030060c.471_472insGGCAp.A157fs-8.239E-6Ruzzo2019 G
SAMD5     AU073003chr6:
147926056-147926056
AGintergenicDe novo--Yuen2017 G
SAMD5     7-0127-003chr6:
148248616-148248616
GAintergenicDe novo--Yuen2017 G
SAMD5     AU063005chr6:
148540594-148540594
ATintergenicDe novo--Yuen2017 G
SAMD5     AU1988302chr6:
147948587-147948587
TCintergenicDe novo--Yuen2017 G
SAMD5     1-0007-003chr6:
148101229-148101229
AGintergenicDe novo--Yuen2017 G
SAMD5     5-0109-003chr6:
148270167-148270167
TCintergenicDe novo--Yuen2017 G
SAMD5     AU1933302chr6:
147967545-147967545
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More