or
or
Exact

Results for "DAB1"

Variant Events: 70

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DAB1     2-0144-003chr1:
57796928-57796928
AGintronicDe novo--Yuen2017 G
DAB1     2-0309-004chr1:
58109501-58109501
AGintronicDe novo--Yuen2017 G
DAB1     2-1184-003chr1:
58416053-58416053
AGintronicDe novo--Yuen2016 G
Yuen2017 G
DAB1     AU4392302chr1:
58774623-58774623
AGintergenicDe novo--Yuen2017 G
DAB1     AU1952305chr1:
58174218-58174218
TCintronicDe novo--Yuen2017 G
DAB1     1-0436-003chr1:
57500516-57500516
GCintronicDe novo--Yuen2016 G
Yuen2017 G
DAB1     2-1265-003chr1:
58585633-58585633
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DAB1     2-1315-003chr1:
57730970-57730970
GAintronicDe novo--Yuen2016 G
Yuen2017 G
DAB1     AU2100302chr1:
57834252-57834252
CTintronicDe novo--Yuen2017 G
DAB1     1-0285-004chr1:
58457290-58457290
CTintronicDe novo--Yuen2017 G
DAB1     13946.p1chr1:
58771663-58771663
CAintergenicDe novo--Turner2016 G
DAB1     2-1378-003chr1:
57494928-57494928
TGintronicDe novo--Yuen2017 G
DAB1     1-0433-004chr1:
57527856-57527856
CTintronicDe novo--Yuen2017 G
DAB1     2-1299-003chr1:
58120922-58120922
CGintronicDe novo--Yuen2017 G
DAB1     1-0469-003chr1:
57962839-57962839
CTintronicDe novo--Yuen2017 G
DAB1     2-1356-003chr1:
58086700-58086714
TGAGAGAGAGAGAGATGAGAGAGAGAGAintronicDe novo--Yuen2017 G
DAB1     2-1501-003chr1:
58784481-58784481
TCintergenicDe novo--Yuen2017 G
DAB1     2-0713-003chr1:
58825157-58825157
TCintergenicDe novo--Yuen2017 G
DAB1     2-1518-003chr1:
57842140-57842140
TAintronicDe novo--Yuen2017 G
DAB1     1-0344-003chr1:
58411158-58411158
CTintronicDe novo--Yuen2017 G
DAB1     AU2951302chr1:
58789368-58789368
CTintergenicDe novo--Yuen2017 G
DAB1     AU2951303chr1:
58789368-58789368
CTintergenicDe novo--Yuen2017 G
DAB1     2-0063-003chr1:
57703234-57703234
GAintronicDe novo--Yuen2017 G
DAB1     1-0986-003chr1:
58042175-58042175
GTintronicDe novo--Yuen2017 G
DAB1     2-1283-004chr1:
57756550-57756550
AATATTintronicDe novo--Yuen2017 G
DAB1     1-0279-004chr1:
57775556-57775556
CGintronicDe novo--Yuen2017 G
DAB1     1-0279-004chr1:
57624869-57624869
CTintronicDe novo--Yuen2017 G
DAB1     1-0404-003chr1:
58416488-58416488
ATintronicDe novo--Yuen2017 G
DAB1     1-0225-003chr1:
58842096-58842096
ATintergenicDe novo--Yuen2017 G
DAB1     1-0404-003chr1:
58415910-58415910
AGintronicDe novo--Yuen2017 G
DAB1     1-0225-003chr1:
58573275-58573299
CTGTTTTTGTTTTTGTTTTTGTTTTCTGTTTTTGTTTTTGTTTTintronicDe novo--Yuen2017 G
DAB1     AU012803chr1:
57867122-57867122
AGintronicDe novo--Yuen2017 G
DAB1     2-0007-004chr1:
58904649-58904649
ATintergenicDe novo--Yuen2017 G
DAB1     AU3122301chr1:
58830363-58830363
GTintergenicDe novo--Yuen2017 G
DAB1     1-0404-003chr1:
58880822-58880836
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
DAB1     1-0404-003chr1:
58416592-58416592
ATintronicDe novo--Yuen2017 G
DAB1     12430.p1chr1:
57839519-57839519
AGintronicDe novo--Werling2018 G
DAB1     2-1189-003chr1:
58226315-58226342
GACACACACACACACAGACACACACACAGACACACACACACAGACACACACACAintronicDe novo--Yuen2017 G
DAB1     2-1297-004chr1:
57509246-57509246
GAintronicDe novo--Yuen2017 G
DAB1     2-1143-003chr1:
58367385-58367385
CTintronicDe novo--Yuen2017 G
DAB1     AU039304chr1:
58286991-58286991
ATintronicDe novo--Yuen2017 G
DAB1     1-0139-005chr1:
58451539-58451553
AACCTAAGTGATCACAintronicDe novo--Yuen2017 G
DAB1     1-0006-004chr1:
57467805-57467805
TAintronicDe novo--Yuen2017 G
DAB1     2-1562-003chr1:
58607971-58607971
GAintronicDe novo--Yuen2017 G
DAB1     3-0442-000chr1:
58729009-58729009
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
DAB1     AU4219302chr1:
58507400-58507400
TCintronicDe novo--Yuen2017 G
DAB1     1-0629-003chr1:
57803656-57803673
CCTTCTTCTTCTTCTTCTCCTTCTTCTTCTTCTintronicDe novo--Yuen2017 G
DAB1     2-1526-004chr1:
58415213-58415213
CCTintronicDe novo--Yuen2017 G
DAB1     5-0065-003chr1:
58579879-58579879
AGintronicDe novo--Yuen2017 G
DAB1     2-1341-003chr1:
58764381-58764381
GAintergenicDe novo--Yuen2017 G
DAB1     AU3859301chr1:
58298561-58298561
TGintronicDe novo--Yuen2017 G
DAB1     AU1933302chr1:
58835179-58835179
GAintergenicDe novo--Yuen2017 G
DAB1     AU3175303chr1:
58880887-58880896
CAGAAGAAGACAGAAGAintergenicDe novo--Yuen2017 G
DAB1     AU4033303chr1:
58595880-58595880
GCintronicDe novo--Yuen2017 G
DAB1     2-1364-003chr1:
57916817-57916817
TCintronicDe novo--Yuen2017 G
DAB1     AU3712302chr1:
58543804-58543804
TCintronicDe novo--Yuen2017 G
DAB1     AU2029301chr1:
57572963-57572963
GAintronicDe novo--Yuen2017 G
DAB1     2-1277-003chr1:
58272540-58272540
AGintronicDe novo--Yuen2017 G
DAB1     2-1626-003chr1:
58361308-58361308
ATintronicDe novo--Yuen2017 G
DAB1     1-0978-003chr1:
58740790-58740790
GAintergenicDe novo--Yuen2017 G
DAB1     2-1626-003chr1:
58361302-58361302
ATintronicDe novo--Yuen2017 G
DAB1     AU3638302chr1:
57545625-57545625
GAintronicDe novo--Yuen2017 G
DAB1     2-1330-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
DAB1     AU1933301chr1:
58299222-58299222
GAintronicDe novo--Yuen2017 G
DAB1     AU060004chr1:
58712476-58712476
GAintronicDe novo--Yuen2017 G
DAB1     1-0804-003chr1:
58616736-58616736
TGintronicDe novo--Yuen2017 G
DAB1     AU1894303chr1:
58217709-58217709
CTintronicDe novo--Yuen2017 G
DAB1     A4chr1:
58728987-58728987
TCintergenicDe novo--Wu2018 G
DAB1     5-0003-004chr1:
58437764-58437764
ATintronicDe novo--Yuen2017 G
DAB1     1-0059-003chr1:
57621079-57621079
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More