or
or
Exact

Results for "ADARB1"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADARB1     SP0040659chr21:
46641951-46641951
CTexonicDe novononsynonymous SNVNM_001112
NM_001160230
NM_015833
NM_015834
c.C1945T
c.C1945T
c.C2065T
c.C2065T
p.R649C
p.R649C
p.R689C
p.R689C
12.62-Feliciano2019 E
ADARB1     AU3874303chr21:
46647920-46647920
CTintergenicDe novo--Yuen2017 G
ADARB1     AU072504chr21:
46655652-46655652
GAintergenicDe novo--Yuen2017 G
ADARB1     A19chr21:
46547739-46547739
CTintronicDe novo--Wu2018 G
ADARB1     1-0441-003chr21:
46529157-46529157
TCintronicDe novo--Yuen2017 G
ADARB1     2-0319-003chr21:
46554120-46554120
GGTGCCCGACAGTGGTGTGTGCACCCGACGGGGGTAintronicDe novo--Yuen2017 G
ADARB1     2-1459-003chr21:
46510509-46510509
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ADARB1     AU3779302chr21:
46553610-46553610
CCAGTintronicDe novo--Yuen2017 G
ADARB1     14321.p1chr21:
46570567-46570567
TTAintronicDe novo--Werling2018 G
ADARB1     086-09-110952chr21:
46602618-46602618
TCexonicDe novosynonymous SNVNM_001112
NM_001160230
NM_015833
NM_015834
c.T1197C
c.T1197C
c.T1197C
c.T1197C
p.S399S
p.S399S
p.S399S
p.S399S
--Satterstrom2020 E
ADARB1     1-0358-003chr21:
46666757-46666757
GTintergenicDe novo--Yuen2017 G
ADARB1     2-1391-004chr21:
46595725-46595725
GAexonicDe novononsynonymous SNVNM_001112
NM_001160230
NM_015833
NM_015834
c.G109A
c.G109A
c.G109A
c.G109A
p.E37K
p.E37K
p.E37K
p.E37K
11.548.275E-6Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More