or
or
Exact

Results for "LOC101928516"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC101928516    2-1269-003chr6:
75297340-75297340
GAncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LOC101928516    AU2777302chr6:
75537241-75537241
GAintergenicDe novo--Yuen2017 G
LOC101928516    AU2792302chr6:
75780086-75780086
GAintergenicDe novo--Yuen2017 G
LOC101928516    1-0651-003chr6:
75042945-75042945
TAncRNA_intronicDe novo--Yuen2017 G
LOC101928516    14015.p1chr6:
74847867-74847867
CTncRNA_intronicDe novo--Turner2016 G
LOC101928516    AU027506chr6:
74824584-74824584
CAncRNA_intronicDe novo--Yuen2017 G
LOC101928516    1-0673-003chr6:
75772604-75772604
CTintergenicDe novo--Yuen2017 G
LOC101928516    2-0142-004chr6:
75302031-75302031
TCncRNA_intronicDe novo--Yuen2017 G
LOC101928516    1-0191-004chr6:
75626229-75626229
GAintergenicDe novo--Yuen2017 G
LOC101928516    AU4033304chr6:
75595441-75595449
GATATTGGTGATATTGGTATATTGGTintergenicDe novo--Yuen2017 G
LOC101928516    1-0289-003chr6:
75344056-75344056
GAncRNA_intronicDe novo--Yuen2017 G
LOC101928516    2-1629-003chr6:
75369785-75369785
CTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU4234303chr6:
75044360-75044360
AGncRNA_intronicDe novo--Yuen2017 G
LOC101928516    1-0161-004chr6:
74847340-74847340
CTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU024607chr6:
75556214-75556214
AGintergenicDe novo--Yuen2017 G
LOC101928516    AU4260303chr6:
75088440-75088440
CTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    1-0986-003chr6:
75053611-75053611
CTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU3874301chr6:
75436805-75436805
TCintergenicDe novo--Yuen2017 G
LOC101928516    2-0270-004chr6:
75335311-75335311
GAncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU4215302chr6:
74796360-74796360
GTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU3889305chr6:
75207045-75207045
CTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    1-0965-003chr6:
75014312-75014312
TCncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU046904chr6:
75610460-75610460
GAintergenicDe novo--Yuen2017 G
LOC101928516    1-0225-003chr6:
75340656-75340659
TAAATAAncRNA_intronicDe novo--Yuen2017 G
LOC101928516    2-1343-003chr6:
75647711-75647712
AGAintergenicDe novo--Yuen2017 G
LOC101928516    7-0191-003chr6:
75089060-75089060
AGncRNA_intronicDe novo--Yuen2017 G
LOC101928516    1-0627-005chr6:
74808271-74808271
TAncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU1542303chr6:
75582091-75582091
GCintergenicDe novo--Yuen2017 G
LOC101928516    AU3881301chr6:
75107170-75107170
TCncRNA_intronicDe novo--Yuen2017 G
LOC101928516    2-1738-003chr6:
74908089-74908089
CTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    5-0050-004chr6:
75530353-75530353
AGintergenicDe novo--Yuen2017 G
LOC101928516    AU4487302chr6:
75523501-75523501
ATintergenicDe novo--Yuen2017 G
LOC101928516    AU2162302chr6:
75029190-75029190
ACncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU3888302chr6:
74836432-74836432
CTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    2-1112-003chr6:
74792030-74792030
GTncRNA_intronicDe novo--Yuen2017 G
LOC101928516    1-0104-004chr6:
74996275-74996275
ACncRNA_intronicDe novo--Yuen2017 G
LOC101928516    2-1581-003chr6:
75179385-75179385
AGncRNA_intronicDe novo--Yuen2017 G
LOC101928516    AU006804chr6:
75475518-75475518
CTintergenicDe novo--Yuen2017 G
LOC101928516    5-0148-003chr6:
75134954-75134954
AGncRNA_intronicDe novo--Yuen2017 G
LOC101928516    5-0109-003chr6:
75250528-75250528
GAncRNA_intronicDe novo--Yuen2017 G
LOC101928516    13358.p1chr6:
75384884-75384884
CTncRNA_intronicDe novo--Werling2018 G
LOC101928516    2-1526-004chr6:
75090236-75090236
CAncRNA_intronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More