Variant Results

or

or

Results for "ADAM8"

Variant Events: 5

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
ADAM8	SP0117644	chr10: 135081664-135081664	G	GAAGGCCCTTCAAACTCAGCCCAAGCC	intronic		De novo					-	-	Fu2022 E
ADAM8	SP0134751	chr10: 135076600-135076600	G	A	UTR3		De novo					-	-	Fu2022 E
ADAM8	iHART2627	chr10: 135085204-135085206	CTG	C	exonic		Maternal	frameshift deletion	NM_001164490 NM_001109 NM_001164489	c.993_994del c.1110_1111del c.1110_1111del	p.S331fs p.S370fs p.S370fs	-	1.0E-4	Ruzzo2019 G
ADAM8	SP0098944	chr10: 135085306-135085306	T	C	intronic		De novo					-	-	Fu2022 E
ADAM8	11251.p1	chr10: 135085034-135085034	C	CG	exonic		De novo	frameshift insertion	NM_001164490 NM_001109 NM_001164489	c.1164dupC c.1281dupC c.1281dupC	p.E389fs p.E428fs p.E428fs	-	1.0E-4	Wilfert2021 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More