or
or
Exact

Results for "ANKRD50"

Variant Events: 34

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ANKRD50     AU3371305chr4:
126040563-126040588
TATATACATATACATATACATATACATATATACATATACATATACAintergenicDe novo--Yuen2017 G
ANKRD50     AU3695303chr4:
125989119-125989119
CTintergenicDe novo--Yuen2017 G
ANKRD50     1-0112-003chr4:
125985710-125985710
GTintergenicDe novo--Yuen2017 G
ANKRD50     AU2792301chr4:
126040658-126040658
TAintergenicDe novo--Yuen2017 G
ANKRD50     iHART1867chr4:
125631188-125631189
TCTexonicMaternalframeshift deletionNM_020337c.478delGp.E160fs--Ruzzo2019 G
ANKRD50     2-1735-003chr4:
125756018-125756018
TGintergenicDe novo--Yuen2017 G
ANKRD50     200675555@1082035048chr4:
125591221-125591221
GTexonicDe novononsynonymous SNVNM_001167882
NM_020337
c.C2674A
c.C3211A
p.P892T
p.P1071T
22.0-Satterstrom2020 E
ANKRD50     AU075703chr4:
126061476-126061476
CAintergenicDe novo--Yuen2017 G
ANKRD50     AU4072303chr4:
126155051-126155051
CTintergenicDe novo--Yuen2017 G
ANKRD50     3-0216-000chr4:
125711748-125711748
CGintergenicDe novo--Yuen2017 G
ANKRD50     2-0300-004chr4:
125598501-125598501
TCintronicDe novo--Yuen2017 G
ANKRD50     A9chr4:
125701031-125701031
GCintergenicDe novo--Wu2018 G
ANKRD50     1-0901-003chr4:
126099719-126099719
AAATTintergenicDe novo--Yuen2017 G
ANKRD50     5-0015-003chr4:
125893252-125893252
CTintergenicDe novo--Yuen2017 G
ANKRD50     Chen2017:80chr4:
125591221-125591221
GTexonicDe novononsynonymous SNVNM_001167882
NM_020337
c.C2674A
c.C3211A
p.P892T
p.P1071T
22.0-Chen2017 E
ANKRD50     2-0057-004chr4:
125832987-125832987
ACintergenicDe novo--Yuen2017 G
ANKRD50     AU2123302chr4:
126160785-126160785
CTintergenicDe novo--Yuen2017 G
ANKRD50     14642.p1chr4:
125633937-125633937
GCupstreamDe novo--Turner2016 G
ANKRD50     1-0296-004chr4:
126083588-126083588
GAintergenicDe novo--Yuen2017 G
ANKRD50     AU3808305chr4:
125929648-125929648
AGintergenicDe novo--Yuen2017 G
ANKRD50     1-0485-003chr4:
125594214-125594214
CTintronicDe novo--Yuen2017 G
ANKRD50     2-1425-003chr4:
125723413-125723413
CGintergenicDe novo--Yuen2017 G
ANKRD50     7-0119-003chr4:
125745942-125745950
GAACAAACAGAACAintergenicDe novo--Yuen2017 G
ANKRD50     1-0290-003chr4:
125843339-125843340
TCTintergenicDe novo--Yuen2017 G
ANKRD50     A7chr4:
125986098-125986098
AGintergenicDe novo--Wu2018 G
ANKRD50     1-0347-003chr4:
125935964-125935964
GAintergenicDe novo--Yuen2017 G
ANKRD50     AU031004chr4:
125894756-125894756
AGintergenicDe novo--Yuen2017 G
ANKRD50     5-0061-003chr4:
125721998-125721998
GAintergenicDe novo--Yuen2017 G
ANKRD50     AU4243302chr4:
125884789-125884789
ATintergenicDe novo--Yuen2017 G
ANKRD50     21854-36022chr4:
125592253-125592254
GCGexonicframeshift deletionNM_001167882
NM_020337
c.1641delG
c.2178delG
p.G547fs
p.G726fs
--Callaghan2019 G
ANKRD50     3-0392-000chr4:
126048929-126048929
AGintergenicDe novo--Yuen2016 G
ANKRD50     1-0206-003chr4:
126168193-126168193
ATintergenicDe novo--Yuen2017 G
ANKRD50     2-1398-004chr4:
125663333-125663333
GAintergenicDe novo--Yuen2017 G
ANKRD50     1-0206-003chr4:
125867690-125867690
AATAATTTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More