Variant Results

or

or

Results for "Zhang2023"

Variant Events: 10

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
PRKD1	Zhang2023:ASD0219	chr14: 30396649-30396680	CCGCTGCGGCAGCTGCCGCCGCCACGGGCAGC	C	exonic		De novo	frameshift deletion	NM_002742	c.39_69del	p.L13fs	-	-	Zhang2023 G
NF1	Zhang2023:ASD0162	chr17: 29679273-29679273	A	T	splicing		De novo	splicing				22.7	-	Zhang2023 G
PTEN	Zhang2023:ASD0294	chr10: 89711930-89711930	A	AA	exonic		De novo	frameshift insertion	NM_000314 NM_001304717	c.548dupA c.1067dupA	p.K183fs p.K356fs	-	-	Zhang2023 G
SCN2A	Zhang2023:ASD0221	chr2: 166165305-166165305	G	A	splicing		De novo	splicing				17.27	-	Zhang2023 G
SCN2A	Zhang2023:ASD0063	chr2: 166237705-166237707	GCT	G	exonic		De novo	frameshift deletion	NM_001040143 NM_001040142 NM_021007	c.4550_4551del c.4550_4551del c.4550_4551del	p.A1517fs p.A1517fs p.A1517fs	-	-	Zhang2023 G
EP300	Zhang2023:ASD0061	chr22: 41565576-41565576	T	G	exonic		De novo	stopgain	NM_001429	c.T4242G	p.Y1414X	51.0	-	Zhang2023 G
SHANK3	Zhang2023:ASD0148	chr22: 51169309-51169322	GGGCTGGGGGCGGG	G	exonic		De novo	frameshift deletion	NM_033517	c.4724_4736del	p.G1575fs	-	-	Zhang2023 G
ADNP	Zhang2023:ASD0134	chr20: 49509095-49509095	T	TT	exonic		De novo	stopgain	NM_001282532 NM_181442 NM_015339 NM_001282531	c.2156dupA c.2156dupA c.2156dupA c.2156dupA	p.Y719_E720delinsX p.Y719_E720delinsX p.Y719_E720delinsX p.Y719_E720delinsX	-	-	Zhang2023 G
ASH1L	Zhang2023:ASD0046	chr1: 155308087-155308088	GA	G	exonic		De novo	frameshift deletion	NM_018489	c.8595delT	p.S2865fs	-	-	Zhang2023 G
SCN2A	Zhang2023:ASD0326	chr2: 166172167-166172167	C	T	exonic		De novo	stopgain	NM_001040143 NM_001040142 NM_021007	c.C1570T c.C1570T c.C1570T	p.R524X p.R524X p.R524X	29.7	-	Zhang2023 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More