or
or
Exact

Results for "LRMDA"

Variant Events: 70

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRMDA     74-0115chr10:
77830946-77830946		CTintronicDe novo--Michaelson2012 G
LRMDA     AU3911301chr10:
78104666-78104666		AGintronicDe novo--Yuen2017 G
LRMDA     7-0242-003chr10:
78144678-78144678		GAintronicDe novo--Yuen2017 G
LRMDA     7-0242-003chr10:
78364020-78364020		AGintergenicDe novo--Yuen2017 G
LRMDA     2-1360-003chr10:
78129573-78129573		ATintronicDe novo--Yuen2016 G
Yuen2017 G
LRMDA     7-0068-003chr10:
77825598-77825598		AGintronicDe novo--Yuen2017 G
LRMDA     2-1391-004chr10:
78504597-78504597		CTintergenicDe novo--Yuen2017 G
LRMDA     7-0250-003chr10:
78318148-78318148		AGintergenicDe novo--Yuen2017 G
LRMDA     AU4176302chr10:
77879092-77879092		GTintronicDe novo--Yuen2017 G
LRMDA     2-1355-004chr10:
78491935-78491935		CTintergenicDe novo--Yuen2017 G
LRMDA     AU4467302chr10:
77351789-77351789		GAintronicDe novo--Yuen2017 G
LRMDA     7-0253-004chr10:
77219259-77219259		GAintronicDe novo--Yuen2017 G
LRMDA     AU4093302chr10:
77850934-77850934		TCintronicDe novo--Yuen2017 G
LRMDA     1-0629-003chr10:
77442566-77442566		GAintronicDe novo--Yuen2017 G
LRMDA     1-1000-003chr10:
77677267-77677267		CTintronicDe novo--Yuen2017 G
LRMDA     AU4159302chr10:
78303961-78303961		GAintronicDe novo--Yuen2017 G
LRMDA     7-0129-003chr10:
77465748-77465748		AGintronicDe novo--Yuen2017 G
LRMDA     AU4283301chr10:
78284742-78284742		CAintronicDe novo--Yuen2017 G
LRMDA     AU3712302chr10:
78196482-78196482		CTintronicDe novo--Yuen2017 G
LRMDA     5-0140-003chr10:
77600355-77600355		GAintronicDe novo--Yuen2017 G
LRMDA     AU3638302chr10:
78509918-78509918		CTintergenicDe novo--Yuen2017 G
LRMDA     2-1438-003chr10:
77699695-77699695		CTintronicDe novo--Yuen2016 G
Yuen2017 G
LRMDA     7-0192-003chr10:
78542423-78542423		GTintergenicDe novo--Yuen2017 G
LRMDA     AU2437302chr10:
78477655-78477655		GAintergenicDe novo--Yuen2017 G
LRMDA     2-1086-003chr10:
78083593-78083593		ACintronicDe novo--Yuen2017 G
LRMDA     AU3809302chr10:
78595771-78595771		TCintergenicDe novo--Yuen2017 G
LRMDA     7-0223-003chr10:
78361846-78361846		AGintergenicDe novo--Yuen2017 G
LRMDA     2-1384-003chr10:
77772940-77772940		AGintronicDe novo--Yuen2017 G
LRMDA     AU3154301chr10:
78010307-78010307		AGintronicDe novo--Yuen2017 G
LRMDA     AU3721301chr10:
77402019-77402019		TGintronicDe novo--Yuen2017 G
LRMDA     2-1348-003chr10:
77784227-77784227		TCintronicDe novo--Yuen2017 G
LRMDA     AU4129303chr10:
77894228-77894228		TAintronicDe novo--Yuen2017 G
LRMDA     5-0064-003chr10:
77676213-77676213		CTintronicDe novo--Yuen2017 G
LRMDA     AU2139305chr10:
78209687-78209687		AGintronicDe novo--Yuen2017 G
LRMDA     AU4452302chr10:
77748229-77748229		ATintronicDe novo--Yuen2017 G
LRMDA     2-1296-003chr10:
78423831-78423831		TCintergenicDe novo--Yuen2017 G
LRMDA     AU031003chr10:
77819319-77819319		AGintronicDe novo--Yuen2017 G
LRMDA     AU1988301chr10:
77888448-77888448		ATintronicDe novo--Yuen2017 G
LRMDA     1-0508-003chr10:
78299834-78299834		AGintronicDe novo--Yuen2017 G
LRMDA     AU078503chr10:
77544293-77544293		TGintronicDe novo--Yuen2017 G
LRMDA     1-0551-003chr10:
78100176-78100176		AGintronicDe novo--Yuen2017 G
LRMDA     5-0017-003chr10:
78270274-78270274		AGintronicDe novo--Yuen2017 G
LRMDA     1-0402-003chr10:
78025362-78025362		CTintronicDe novo--Yuen2017 G
LRMDA     1-0638-003chr10:
77354033-77354033		CTintronicDe novo--Yuen2017 G
LRMDA     7-0248-003chr10:
77903523-77903523		CGintronicDe novo--Yuen2017 G
LRMDA     2-1345-003chr10:
78587364-78587364		CTintergenicDe novo--Yuen2017 G
LRMDA     AU1848302chr10:
78552442-78552442		TAintergenicDe novo--Yuen2017 G
LRMDA     2-1425-003chr10:
77995989-77995989		GAintronicDe novo--Yuen2017 G
LRMDA     1-0382-003chr10:
78120800-78120800		CTintronicDe novo--Yuen2017 G
LRMDA     AU2100302chr10:
78328112-78328112		TAintergenicDe novo--Yuen2017 G
LRMDA     2-1501-003chr10:
78453029-78453029		TCintergenicDe novo--Yuen2017 G
LRMDA     AU3368303chr10:
77930585-77930585		AGintronicDe novo--Yuen2017 G
LRMDA     AU3727303chr10:
78362136-78362136		AGintergenicDe novo--Yuen2017 G
LRMDA     1-0455-004chr10:
77895459-77895459		TCintronicDe novo--Yuen2017 G
LRMDA     AU3451301chr10:
78342225-78342231		GCCACTTGCCACTTCCACTTintergenicDe novo--Yuen2017 G
LRMDA     2-0299-005chr10:
77994770-77994770		AGintronicDe novo--Yuen2017 G
LRMDA     1-0289-003chr10:
77678927-77678927		GAintronicDe novo--Yuen2017 G
LRMDA     7-0251-003chr10:
78599146-78599146		CTintergenicDe novo--Yuen2017 G
LRMDA     AU4284301chr10:
78472210-78472210		GAintergenicDe novo--Yuen2017 G
LRMDA     AU3918301chr10:
77421432-77421439		GATATATAGATATAintronicDe novo--Yuen2017 G
LRMDA     1-0380-003chr10:
77554843-77554843		CTintronicDe novo--Yuen2017 G
LRMDA     2-1143-003chr10:
78107246-78107246		GAintronicDe novo--Yuen2017 G
LRMDA     2-1562-004chr10:
78226053-78226057		GACAAGintronicDe novo--Yuen2017 G
LRMDA     1-0203-003chr10:
77556424-77556424		GAintronicDe novo--Yuen2017 G
LRMDA     2-1368-003chr10:
78211864-78211864		CTintronicDe novo--Yuen2016 G
Yuen2017 G
LRMDA     1-0303-003chr10:
77334385-77334385		CTintronicDe novo--Yuen2017 G
LRMDA     1-0450-003chr10:
77349425-77349425		GCintronicDe novo--Yuen2017 G
LRMDA     AU1725306chr10:
77258650-77258650		AGintronicDe novo--Yuen2017 G
LRMDA     2-0198-003chr10:
77436317-77436317		CGintronicDe novo--Yuen2017 G
LRMDA     2-0296-004chr10:
77756779-77756779		CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More

VariCarta Copyright © 2016-2020 Contact Us