or
or
Exact

Results for "ARSF"

Variant Events: 6

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARSF     AU4027306chrX:
3092161-3092161
CTintergenicDe novo--Yuen2017 G
ARSF     AU009903chrX:
2980315-2980315
AGintronicDe novo--Yuen2017 G
ARSF     AU4070301chrX:
3091537-3091544
ATATTTTTATintergenicDe novo--Yuen2017 G
ARSF     2-1438-003chrX:
3185665-3185681
ATGTGTGTGTGTGTGTGATGTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
ARSF     1-0531-003chrX:
2968523-2968523
GCintronicDe novo--Yuen2017 G
ARSF     AU039903chrX:
3002678-3002678
GTexonicUnknownnonsynonymous SNVNM_001201538
NM_001201539
NM_004042
c.G801T
c.G801T
c.G801T
p.M267I
p.M267I
p.M267I
0.245.0E-4Chahrour2012 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More