or
or
Exact

Results for "AFF2"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AFF2     AU1328302chrX:
148039954-148039954
CGexonicUnknownnonsynonymous SNVNM_001170628
NM_001169122
NM_001169124
NM_001169125
NM_001169123
NM_002025
c.C1579G
c.C2557G
c.C2551G
c.C2539G
c.C2626G
c.C2656G
p.P527A
p.P853A
p.P851A
p.P847A
p.P876A
p.P886A
24.70.0012Chahrour2012 E
AFF2     ASD-667chrX:
148038084-148038084
CTexonicMaternalnonsynonymous SNVNM_001170628
NM_001169122
NM_001169124
NM_001169125
NM_001169123
NM_002025
c.C1432T
c.C2410T
c.C2404T
c.C2392T
c.C2479T
c.C2509T
p.R478C
p.R804C
p.R802C
p.R798C
p.R827C
p.R837C
18.988.016E-5Du2018 E
AFF2     AU3398301chrX:
147662996-147662998
TACTintronicDe novo--Yuen2017 G
AFF2     5-0054-003chrX:
147696141-147696155
CCTTTCTTTCTTTCTCCTTTCTTTCTintronicDe novo--Yuen2017 G
AFF2     1-0736-003chrX:
148250704-148250704
CTintergenicDe novo--Yuen2017 G
AFF2     AU4239301chrX:
147662743-147662762
ATATACGTATACGTATACGTATATACGTATACGTintronicDe novo--Yuen2017 G
AFF2     AU2427301chrX:
148425015-148425015
CTintergenicDe novo--Yuen2017 G
AFF2     AU-4400chrX:
148044334-148044334
GAexonicInheritednonsynonymous SNVNM_001170628
NM_001169122
NM_001169124
NM_001169125
NM_001169123
NM_002025
c.G1703A
c.G2681A
c.G2675A
c.G2663A
c.G2750A
c.G2780A
p.R568H
p.R894H
p.R892H
p.R888H
p.R917H
p.R927H
26.90.0015Yu2013 E
AFF2     1-0976-003chrX:
147877353-147877375
AAAAATATATATATATATATATAAAintronicDe novo--Yuen2017 G
AFF2     1-0677-003chrX:
148418171-148418171
AGintergenicDe novo--Yuen2017 G
AFF2     AU4103301chrX:
148299034-148299034
CTintergenicDe novo--Yuen2017 G
AFF2     1-0257-003chrX:
148099166-148099166
TGintergenicDe novo--Yuen2017 G
AFF2     1-0935-003chrX:
148535474-148535474
CGintergenicDe novo--Yuen2017 G
AFF2     2-1269-003chrX:
148069012-148069012
GAexonicInheritednonsynonymous SNVNM_001170628
NM_001169122
NM_001169124
NM_001169125
NM_001169123
NM_002025
c.G2662A
c.G3634A
c.G3634A
c.G3622A
c.G3709A
c.G3739A
p.V888I
p.V1212I
p.V1212I
p.V1208I
p.V1237I
p.V1247I
27.91.141E-5Jiang2013 G
AFF2     5-0099-003chrX:
148508916-148508916
CGintergenicDe novo--Yuen2017 G
AFF2     1-0572-003chrX:
147698005-147698005
GAintronicDe novo--Yuen2017 G
AFF2     2-1436-003chrX:
147869923-147869923
AGintronicDe novo--Yuen2017 G
AFF2     AU4006302chrX:
148199372-148199385
GTATATATATATATGTATATATATATATATintergenicDe novo--Yuen2017 G
AFF2     2-1383-003chrX:
148311181-148311181
TCintergenicDe novo--Yuen2017 G
AFF2     2-0713-003chrX:
148426388-148426388
TGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More