or
or
Exact

Results for "HERC1"

Variant Events: 34

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HERC1     1-0826-004chr15:
64083898-64083898
TCintronicDe novo--Yuen2017 G
HERC1     004-05-102519chr15:
63928210-63928210
GAexonicDe novostopgainNM_003922c.C12364Tp.Q4122X54.0-Fu2022 E
Satterstrom2020 E
HERC1     AU3912302chr15:
64034450-64034450
ACintronicDe novo--Yuen2017 G
HERC1     JASD_Fam0053chr15:
64047525-64047525
CTsplicingDe novosplicing33.0-Takata2018 E
HERC1     JASD_Fam0128chr15:
64039940-64039940
GAexonicDe novosynonymous SNVNM_003922c.C2337Tp.L779L--Takata2018 E
HERC1     2-0198-005chr15:
64011665-64011665
CTintronicDe novo--Yuen2017 G
HERC1     2-0242-003chr15:
63909354-63909354
CCCCCGCTintronicDe novo--Yuen2017 G
HERC1     AU3874302chr15:
64052058-64052058
TCintronicDe novo--Yuen2017 G
HERC1     iHART2039chr15:
63932419-63932419
GAexonicMaternalstopgainNM_003922c.C11833Tp.Q3945X53.0-Ruzzo2019 G
HERC1     SP0053825chr15:
64048682-64048682
GTexonicstopgainNM_003922c.C1487Ap.S496X38.0-Antaki2022 GE
HERC1     08C75173chr15:
63999046-63999046
ATintronicDe novo--Satterstrom2020 E
HERC1     AU3790302chr15:
63996506-63996506
CTintronicDe novo--Yuen2017 G
HERC1     08C72441chr15:
64011140-64011140
ACintronicDe novo--Satterstrom2020 E
HERC1     12871.p1chr15:
64017613-64017613
AGexonicDe novononsynonymous SNVNM_003922c.T3446Cp.I1149T17.97-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
HERC1     1-0080-003chr15:
63917156-63917156
CTintronicDe novo--Yuen2017 G
HERC1     9190789chr15:
63922772-63922772
CTexonicDe novononsynonymous SNVNM_003922c.G12859Ap.V4287I14.6-Fu2022 E
HERC1     11391.p1chr15:
63935113-63935113
TGintronicDe novo--Satterstrom2020 E
HERC1     2-0198-004chr15:
64011665-64011665
CTintronicDe novo--Yuen2017 G
HERC1     P0415chr15:
63927042-63927042
TAexonicDe novostopgainNM_003922c.A12460Tp.K4154X55.0-Hashimoto2016 E
HERC1     12950.p1chr15:
64008491-64008491
GCintronicDe novo--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
HERC1     2-0007-004chr15:
64097512-64097512
TCintronicDe novo--Yuen2017 G
HERC1     2-1264-003chr15:
64038126-64038126
TCintronicDe novo--Yuen2016 G
Yuen2017 G
HERC1     1-0126-003chr15:
63938162-63938162
GAintronicDe novo--Yuen2017 G
HERC1     1-0593-003chr15:
63946251-63946265
TGAGAAGAGAAGAGATGAGAAGAGAintronicDe novo--Yuen2017 G
HERC1     2-1381-003chr15:
64034908-64034908
GAintronicDe novo--Yuen2017 G
HERC1     SP0010256chr15:
63915071-63915071
AGexonicDe novononsynonymous SNVNM_003922c.T13631Cp.V4544A24.5-Fu2022 E
HERC1     SP0049557chr15:
63966848-63966848
GAexonicDe novosynonymous SNVNM_003922c.C7539Tp.L2513L-4.285E-5Fu2022 E
HERC1     SP0110352chr15:
63967030-63967030
TCexonicDe novononsynonymous SNVNM_003922c.A7357Gp.S2453G2.038-Fu2022 E
HERC1     2-0122-003chr15:
64126908-64126908
AGupstreamDe novo--Yuen2017 G
HERC1     2-1205-003chr15:
64095772-64095772
CAintronicDe novo--Yuen2017 G
HERC1     1-0006-003chr15:
63973235-63973238
TTAATintronicDe novo--Yuen2017 G
HERC1     14682.p1chr15:
63937724-63937724
CTexonicDe novononsynonymous SNVNM_003922c.G11036Ap.R3679H16.480.0016Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Wilfert2021 G
HERC1     SSC06434chr15:
64017613-64017613
AGexonicDe novononsynonymous SNVNM_003922c.T3446Cp.I1149T17.97-Fu2022 E
Lim2017 E
HERC1     SP0064355chr15:
63948581-63948581
ACintronicDe novo--Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More