or
or
Exact

Results for "NRP2"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NRP2     1-0593-003chr2:
206788485-206788485
GAintergenicDe novo--Yuen2017 G
NRP2     AU031004chr2:
206799928-206799928
AGintergenicDe novo--Yuen2017 G
NRP2     2-1338-003chr2:
206830137-206830137
CGintergenicDe novo--Yuen2017 G
NRP2     SSC08761chr2:
206617656-206617656
CTexonicDe novosynonymous SNVNM_003872
NM_018534
NM_201266
NM_201267
NM_201279
c.C2001T
c.C2001T
c.C2001T
c.C2001T
c.C2001T
p.T667T
p.T667T
p.T667T
p.T667T
p.T667T
--Lim2017 E
NRP2     13829.p1chr2:
206587456-206587456
CAintronicMosaic--Dou2017 E
NRP2     1-0160-004chr2:
206684881-206684881
CTintergenicDe novo--Yuen2017 G
NRP2     7-0249-004chr2:
206639025-206639038
TGAGAGAGAGAGAGTGAGAGAGAGAGintronicDe novo--Yuen2017 G
NRP2     1-0354-006chr2:
206779097-206779097
TAintergenicDe novo--Yuen2017 G
NRP2     PN400209chr2:
206590778-206590778
ATexonicUnknownnonsynonymous SNVNM_003872
NM_018534
NM_201264
NM_201266
NM_201267
NM_201279
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
21.90.0033Leblond2019 E
NRP2     PN400352chr2:
206588629-206588629
CTexonicUnknownnonsynonymous SNVNM_003872
NM_018534
NM_201264
NM_201266
NM_201267
NM_201279
c.C785T
c.C785T
c.C785T
c.C785T
c.C785T
c.C785T
p.A262V
p.A262V
p.A262V
p.A262V
p.A262V
p.A262V
33.04.0E-4Leblond2019 E
NRP2     PN400528chr2:
206588629-206588629
CTexonicUnknownnonsynonymous SNVNM_003872
NM_018534
NM_201264
NM_201266
NM_201267
NM_201279
c.C785T
c.C785T
c.C785T
c.C785T
c.C785T
c.C785T
p.A262V
p.A262V
p.A262V
p.A262V
p.A262V
p.A262V
33.04.0E-4Leblond2019 E
NRP2     7-0095-003chr2:
206812955-206812955
CTintergenicDe novo--Yuen2017 G
NRP2     AU4191302chr2:
206837336-206837336
GTintergenicDe novo--Yuen2017 G
NRP2     5-0018-003chr2:
206603808-206603808
CTintronicDe novo--Yuen2017 G
NRP2     AU1795302chr2:
206755353-206755353
AGintergenicDe novo--Yuen2017 G
NRP2     AU3190305chr2:
206760540-206760540
AGintergenicDe novo--Yuen2017 G
NRP2     1-0025-006chr2:
206630869-206630869
CTintronicDe novo--Yuen2017 G
NRP2     PN400125chr2:
206590778-206590778
ATexonicUnknownnonsynonymous SNVNM_003872
NM_018534
NM_201264
NM_201266
NM_201267
NM_201279
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
21.90.0033Leblond2019 E
NRP2     PN400241chr2:
206588629-206588629
CTexonicUnknownnonsynonymous SNVNM_003872
NM_018534
NM_201264
NM_201266
NM_201267
NM_201279
c.C785T
c.C785T
c.C785T
c.C785T
c.C785T
c.C785T
p.A262V
p.A262V
p.A262V
p.A262V
p.A262V
p.A262V
33.04.0E-4Leblond2019 E
NRP2     13772.p1chr2:
206617656-206617656
CTexonicDe novosynonymous SNVNM_003872
NM_018534
NM_201266
NM_201267
NM_201279
c.C2001T
c.C2001T
c.C2001T
c.C2001T
c.C2001T
p.T667T
p.T667T
p.T667T
p.T667T
p.T667T
--Krumm2015 E
Satterstrom2020 E
NRP2     PN400266chr2:
206590778-206590778
ATexonicUnknownnonsynonymous SNVNM_003872
NM_018534
NM_201264
NM_201266
NM_201267
NM_201279
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
21.90.0033Leblond2019 E
NRP2     PN400504chr2:
206590778-206590778
ATexonicUnknownnonsynonymous SNVNM_003872
NM_018534
NM_201264
NM_201266
NM_201267
NM_201279
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
c.A962T
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
p.N321I
21.90.0033Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More