or
or
Exact

Results for "SETD2"

Variant Events: 44

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SETD2     13783.p1chr3:
47164944-47164944
ATexonicPaternalstopgainNM_014159c.T1182Ap.C394X28.6-O’Roak2012a T
SETD2     12736.p1chr3:
47205396-47205396
GAexonicMaternalstopgainNM_014159c.C19Tp.Q7X26.67.372E-5O’Roak2012a T
SETD2     12565.p1chr3:
47098932-47098933
ATAexonicDe novoframeshift deletionNM_014159c.6341delAp.N2114fs--Dong2014 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2012b E
Satterstrom2020 E
Wang2020 T
Wang2020 T
Wilfert2021 G
Willsey2013 E
SETD2     Alvarez-Mora2016:ASD-20chr3:
47103768-47103768
AGexonicPaternalnonsynonymous SNVNM_014159c.T6178Cp.S2060P19.22-Alvarez-Mora2016 T
SETD2     AU1542301chr3:
47158629-47158629
GAintronicDe novo--Yuen2017 G
SETD2     Lim2017:37403chr3:
47166005-47166005
TAexonicDe novononsynonymous SNVNM_014159c.A121Tp.I41F11.88-Lim2017 E
SETD2     150942042chr3:
47164140-47164140
TCexonicDe novosynonymous SNVNM_014159c.A1986Gp.Q662Q-2.0E-4Satterstrom2020 E
SETD2     AU06304chr3:
47161785-47161785
GAexonicDe novosynonymous SNVNM_014159c.C4341Tp.P1447P--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
SETD2     10C117850chr3:
47164140-47164140
TCexonicDe novosynonymous SNVNM_014159c.A1986Gp.Q662Q-2.0E-4DeRubeis2014 E
Kosmicki2017 E
SETD2     AU4250301chr3:
47161506-47161506
TCintronicDe novo--Yuen2017 G
SETD2     1-0454-003chr3:
47182080-47182080
GAintronicDe novo--Yuen2016 G
SETD2     351980chr3:
47164586-47164587
GTGexonicUnknownframeshift deletionNM_014159c.1539delAp.K513fs--Wang2020 T
Wang2020 T
Wang2020 T
SETD2     66905894chr3:
47164452-47164457
GGTAGAGexonicUnknownframeshift deletionNM_014159c.1669_1673delp.S557fs--Wang2020 T
Wang2020 T
SETD2     SF0075343.p1chr3:
47162475-47162475
CTexonicDe novostopgainNM_014159c.G3651Ap.W1217X37.0-Wang2020 T
SETD2     12175.p1chr3:
47101600-47101600
CAintronicDe novo--Turner2016 G
SETD2     3-0065-000chr3:
47169922-47169922
TCintronicDe novo--Yuen2017 G
SETD2     14036.p1chr3:
47168087-47168087
GTintronicMosaic Pat.--Dou2017 E
SETD2     474.101chr3:
47061326-47061326
GAexonicUnknownnonsynonymous SNVNM_014159c.C7355Tp.S2452L21.04.12E-5Wang2020 T
SETD2     HEN0389.p1chr3:
47164927-47164927
CTexonicUnknownnonsynonymous SNVNM_014159c.G1199Ap.R400Q22.3-Wang2020 T
Wang2020 T
Wang2020 T
SETD2     AN00090chr3:
47164663-47164663
TCexonicUnknownnonsynonymous SNVNM_014159c.A1463Gp.Y488C13.812.727E-5D’Gama2015 T
SETD2     1-0458-003chr3:
47068050-47068050
TCintronicDe novo--Yuen2017 G
SETD2     AU3888302chr3:
47063506-47063506
GAintronicDe novo--Yuen2017 G
SETD2     D’Gama2015:5297chr3:
47127776-47127776
GTexonicUnknownnonsynonymous SNVNM_014159c.C5306Ap.S1769Y14.588.251E-6D’Gama2015 T
SETD2     UK20244chr3:
47144882-47144882
GCexonicMosaicnonsynonymous SNVNM_014159c.C4871Gp.S1624C26.1-D’Gama2015 T
SETD2     Husson2020:188chr3:
47139465-47139465
GAexonicDe novostopgainNM_014159c.C5122Tp.R1708X46.0-Husson2020 E
SETD2     03C15985chr3:
47088078-47088078
CTexonicUnknownnonsynonymous SNVNM_014159c.G6997Ap.G2333R25.2-Stessman2017 T
Wang2020 T
Wang2020 T
SETD2     14569.p1chr3:
47166005-47166005
TAexonicDe novononsynonymous SNVNM_014159c.A121Tp.I41F11.88-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
SETD2     03C16162chr3:
47098880-47098880
GAexonicUnknownnonsynonymous SNVNM_014159c.C6394Tp.R2132W17.548.238E-6Stessman2017 T
Wang2020 T
Wang2020 T
SETD2     G01-GEA-203-HIchr3:
47127782-47127800
AGGCAGGACTGTGAGTGTGAexonicDe novononframeshift deletionNM_014159c.5282_5299delp.1761_1767del--Satterstrom2020 E
SETD2     4974-12Dchr3:
47103785-47103785
GAexonicUnknownnonsynonymous SNVNM_014159c.C6161Tp.P2054L19.196.589E-5Wang2020 T
SETD2     1-0595-005chr3:
47060996-47060996
GAintronicDe novo--Yuen2017 G
SETD2     AU4235301chr3:
47076781-47076781
CTintronicDe novo--Yuen2017 G
SETD2     HEN455.p1chr3:
47164927-47164927
CTexonicUnknownnonsynonymous SNVNM_014159c.G1199Ap.R400Q22.3-Wang2020 T
Wang2020 T
SETD2     HEN477.p1chr3:
47155365-47155365
CTsplicingUnknownsplicing23.1-Wang2020 T
Wang2020 T
SETD2     GX0390.p1chr3:
47103785-47103785
GAexonicUnknownnonsynonymous SNVNM_014159c.C6161Tp.P2054L19.196.589E-5Wang2020 T
Wang2020 T
SETD2     M16165 Complex Event; expand row to view variants  Unknownnonsynonymous SNVNM_014159
NM_014159
c.C6161G
c.C6161T
p.P2054R
p.P2054L
19.196.589E-5Stessman2017 T
Stessman2017 T
SETD2     2-1402-003chr3:
47074924-47074924
GTintronicDe novo--Yuen2017 G
SETD2     2-1174-006chr3:
47068050-47068050
TCintronicDe novo--Yuen2017 G
SETD2     BK828-01chr3:
47061326-47061326
GAexonicUnknownnonsynonymous SNVNM_014159c.C7355Tp.S2452L21.04.12E-5Wang2020 T
SETD2     BK856-01chr3:
47058735-47058735
CCGTexonicUnknownframeshift insertionNM_014159c.7542_7543insACp.G2515fs--Wang2020 T
Wang2020 T
SETD2     1-0485-003chr3:
47161175-47161175
GAintronicDe novo--Yuen2017 G
SETD2     iHART1777chr3:
47061324-47061324
TTCexonicDe novoframeshift insertionNM_014159c.7356dupGp.K2453fs--Ruzzo2019 G
SETD2     Yalcintepe2021:6chr3:
47164649-47164649
GCexonicnonsynonymous SNVNM_014159c.C1477Gp.R493G13.78-Yalcintepe2021 T
SETD2     556.03chr3:
47098932-47098933
ATAexonicDe novoframeshift deletionNM_014159c.6341delAp.N2114fs--Wang2020 T
Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More