or
or
Exact

Results for "AGAP1"

Variant Events: 48

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AGAP1     1-0495-003chr2:
236739972-236739972
AGintronicDe novo--Yuen2017 G
AGAP1     AU038703chr2:
236852554-236852554
TCintronicDe novo--Yuen2017 G
AGAP1     AU2139303chr2:
237028382-237028382
GAintronicDe novo--Yuen2017 G
AGAP1     2-1303-003chr2:
236843606-236843606
GAintronicDe novo--Yuen2016 G
Yuen2017 G
AGAP1     AU2427301chr2:
236978919-236978919
GAintronicDe novo--Yuen2017 G
AGAP1     AU3124304chr2:
236796473-236796473
GAintronicDe novo--Yuen2017 G
AGAP1     DEASD_0073_001chr2:
236658972-236658972
CTintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
AGAP1     2-1386-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
AGAP1     1-0483-003chr2:
236444956-236444996
CACACACACAGCAGGACCCTGGGGTTTGTGTGTGGCATCCTCintronicDe novo--Yuen2016 G
AGAP1     1-0985-003chr2:
237031246-237031250
ACTCTACTintronicDe novo--Yuen2017 G
AGAP1     1-0148-005chr2:
236961370-236961370
TCintronicDe novo--Yuen2017 G
AGAP1     2-1306-004chr2:
236413891-236413891
CCTintronicDe novo--Yuen2017 G
AGAP1     3-0448-000chr2:
236932550-236932550
CTintronicDe novo--Yuen2017 G
AGAP1     1-0010-005chr2:
236796932-236796932
AGintronicDe novo--Yuen2017 G
AGAP1     2-1308-003chr2:
237041147-237041147
CTdownstreamDe novo--Yuen2016 G
Yuen2017 G
AGAP1     AU3846303chr2:
236661885-236661885
GAintronicDe novo--Yuen2017 G
AGAP1     2-1186-003chr2:
236535267-236535267
CGintronicDe novo--Yuen2016 G
Yuen2017 G
AGAP1     AU011604chr2:
236976196-236976196
CTintronicDe novo--Yuen2017 G
AGAP1     1-0067-005chr2:
236869983-236869983
CTintronicDe novo--Yuen2017 G
AGAP1     AU4159302chr2:
236408577-236408577
CTintronicDe novo--Yuen2017 G
AGAP1     AU3782302chr2:
236579776-236579776
GTintronicDe novo--Yuen2017 G
AGAP1     1-0244-003chr2:
236834258-236834258
GAintronicDe novo--Yuen2016 G
Yuen2017 G
AGAP1     2-0296-003chr2:
237047780-237047780
AATintergenicDe novo--Yuen2017 G
AGAP1     11000.p1chr2:
237029030-237029030
GAexonicDe novononsynonymous SNVNM_014914
NM_001037131
c.G2150A
c.G2309A
p.R717H
p.R770H
35.01.729E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
AGAP1     1-0294-003chr2:
236791026-236791028
TCTTCTCCTintronicDe novo--Yuen2017 G
AGAP1     AU078503chr2:
236411730-236411730
GAintronicDe novo--Yuen2017 G
AGAP1     1-0141-003chr2:
236680107-236680107
GAintronicDe novo--Yuen2017 G
AGAP1     AU4149301chr2:
236591293-236591293
ATintronicDe novo--Yuen2017 G
AGAP1     AU3175302chr2:
236852869-236852869
GAintronicDe novo--Yuen2017 G
AGAP1     Cukier2014:17478chr2:
236659033-236659033
GAexonicUnknownnonsynonymous SNVNM_001037131
NM_001244888
NM_014914
c.G574A
c.G574A
c.G574A
p.D192N
p.D192N
p.D192N
29.84.118E-5Cukier2014 E
AGAP1     1-0193-003chr2:
236876069-236876069
TGintronicDe novo--Yuen2017 G
AGAP1     AU3605303chr2:
236531798-236531798
AGintronicDe novo--Yuen2017 G
AGAP1     1-0585-003chr2:
236686357-236686357
AGintronicDe novo--Yuen2017 G
AGAP1     1-0579-003chr2:
237069760-237069760
CTintergenicDe novo--Yuen2017 G
AGAP1     AU3764302chr2:
237009639-237009639
AGintronicDe novo--Yuen2017 G
AGAP1     2-0022-005chr2:
236613015-236613015
GAintronicDe novo--Yuen2017 G
AGAP1     2-1306-003chr2:
236413891-236413891
CCTintronicDe novo--Yuen2017 G
AGAP1     AU3937301chr2:
236474154-236474155
GCGintronicDe novo--Yuen2017 G
AGAP1     2-1355-003chr2:
236984705-236984705
GAintronicDe novo--Yuen2017 G
AGAP1     AU028305chr2:
236866372-236866372
AGintronicDe novo--Yuen2017 G
AGAP1     2-1336-004chr2:
237051396-237051396
TCintergenicDe novo--Yuen2017 G
AGAP1     AU003403chr2:
237031786-237031786
CAintronicDe novo--Yuen2017 G
AGAP1     SSC02254chr2:
237029030-237029030
GAexonicDe novononsynonymous SNVNM_014914
NM_001037131
c.G2150A
c.G2309A
p.R717H
p.R770H
35.01.729E-5Lim2017 E
AGAP1     1-0032-003chr2:
236872461-236872463
CAGCintronicDe novo--Yuen2017 G
AGAP1     1-0935-003chr2:
236844525-236844525
CTintronicDe novo--Yuen2017 G
AGAP1     2-1629-003chr2:
236552609-236552609
CTintronicDe novo--Yuen2017 G
AGAP1     AU047704chr2:
236772381-236772381
CTintronicDe novo--Yuen2017 G
AGAP1     74-0688chr2:
236984963-236984963
GAintronicDe novo--Michaelson2012 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More