Variant Results

or

or

Results for "AP1S2"

Variant Events: 7

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
AP1S2	1-0651-003	chrX: 15942243-15942243	C	G	intergenic		De novo					-	-	Yuen2017 G
AP1S2	AU1987301	chrX: 15860951-15860951	C	A	intronic		De novo					-	-	Yuen2017 G
AP1S2	AU3680302	chrX: 16062829-16062837	GTTTTTTTT	GTTTTTTTTT	intergenic		De novo					-	-	Yuen2017 G
AP1S2	1-0139-003	chrX: 15874355-15874355	G	GTGTACTATAATGTACACAAAAA	intergenic		De novo					-	-	Yuen2017 G
AP1S2	Hu2022:16	chrX: 15870644-15870644	G	A	exonic		Maternal	stopgain	NM_001272071 NM_003916	c.C4T c.C4T	p.Q2X p.Q2X	39.0	-	Hu2022 T
AP1S2	12184.p1	chrX: 15870623-15870623	G	A	exonic		De novo	nonsynonymous SNV	NM_001272071 NM_003916	c.C25T c.C25T	p.R9C p.R9C	17.4	-	Iossifov2014 E Ji2016 E Kosmicki2017 E Satterstrom2020 E
AP1S2	2-1131-003	chrX: 16090789-16090789	A	G	intergenic		De novo					-	-	Yuen2017 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More