or
or
Exact

Results for "NRXN1"

Variant Events: 337

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NRXN1     AU4452302chr2:
52903523-52903523
GAintergenicDe novo--Yuen2017 G
NRXN1     AU1355301chr2:
52832144-52832144
CTintergenicDe novo--Yuen2017 G
NRXN1     mAGRE5784chr2:
51149006-51149006
CAintronicMaternal18.18-Cirnigliaro2023 G
NRXN1     mAGRE1889chr2:
50780064-50780064
CAexonicPaternalstopgainNM_004801
NM_001135659
c.G1420T
c.G1540T
p.E474X
p.E514X
49.0-Cirnigliaro2023 G
NRXN1     AU1308303chr2:
50780064-50780064
CAexonicPaternalstopgainNM_004801
NM_001135659
c.G1420T
c.G1540T
p.E474X
p.E514X
49.0-Cirnigliaro2023 G
NRXN1     AU3760302chr2:
50376489-50376489
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     Husson2020:307chr2:
50850520-50850521
CCCexonicframeshift deletionNM_004801
NM_001135659
c.1065delG
c.1164delG
p.V355fs
p.V388fs
--Husson2020 E
NRXN1     AU3808305chr2:
52237178-52237178
TCintergenicDe novo--Yuen2017 G
NRXN1     AGRE_AU061104chr2:
50755769-50755771
TACTexonicUnknownframeshift deletionNM_004801
NM_001135659
c.2366_2367del
c.2486_2487del
p.C789fs
p.C829fs
--Wang2020 T
NRXN1     AU070007chr2:
52713939-52713939
TGintergenicDe novo--Yuen2017 G
NRXN1     1-0534-006chr2:
50969632-50969632
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     Husson2020::98chr2:
50464056-50464057
CCCexonicDe novoframeshift deletionNM_138735
NM_004801
NM_001135659
c.311delG
c.3416delG
c.3536delG
p.W104fs
p.W1139fs
p.W1179fs
--Husson2020 E
NRXN1     AU4426303chr2:
50542180-50542180
CGintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     AGRE_03C23225chr2:
50733684-50733684
GAexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.C2446T
c.C2566T
p.R816W
p.R856W
20.81.706E-5Wang2020 T
NRXN1     ACGC_M27849chr2:
51255153-51255153
CAexonicUnknownnonsynonymous SNVNM_001135659
NM_004801
c.G259T
c.G259T
p.G87C
p.G87C
25.1-Wang2020 T
NRXN1     ACGC_GD0072.p1chr2:
50149288-50149288
CTexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G1123A
c.G4228A
c.G4438A
p.A375T
p.A1410T
p.A1480T
25.98.239E-6Wang2020 T
NRXN1     AGRE_AU1165302chr2:
50733684-50733684
GAexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.C2446T
c.C2566T
p.R816W
p.R856W
20.81.706E-5Wang2020 T
NRXN1     ACGC_HN0187.p1chr2:
50282131-50282131
CAexonicUnknownnonsynonymous SNVNM_001135659c.G3890Tp.R1297L18.47-Wang2020 T
NRXN1     ACGC_SX0028.p1chr2:
50758385-50758393
ACACGTCCTAGexonicUnknownframeshift substitutionNM_004801
NM_001135659
c.2319_2326C
c.2439_2446C
N/A
N/A
--Wang2020 T
NRXN1     ACGC_SX0080.p1chr2:
50724511-50724511
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2839A
c.G2959A
p.G947R
p.G987R
32.0-Wang2020 T
NRXN1     ACGC_SD0017.p1chr2:
50723223-50723223
ATexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.T2890A
c.T3010A
p.Y964N
p.Y1004N
23.1-Wang2020 T
NRXN1     1-0338-005chr2:
50929083-50929083
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     1-0652-004chr2:
50324588-50324588
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     2-1620-003chr2:
50277024-50277024
TGintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     AU1640302chr2:
51641587-51641587
TGintergenicDe novo--Yuen2017 G
NRXN1     ACGC_M23182chr2:
50724852-50724852
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2498A
c.G2618A
p.G833D
p.G873D
28.9-Wang2020 T
NRXN1     AU061104chr2:
50755770-50755772
ACAAexonicInheritedframeshift deletionNM_004801
NM_001135659
c.2365_2366del
c.2485_2486del
p.C789fs
p.C829fs
--Stessman2017 T
NRXN1     ACGC_HEN0045.p1chr2:
50724852-50724852
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2498A
c.G2618A
p.G833D
p.G873D
28.9-Wang2020 T
NRXN1     AGRE_AU0614312chr2:
50463973-50463973
CTexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G395A
c.G3500A
c.G3620A
p.R132Q
p.R1167Q
p.R1207Q
33.01.657E-5Wang2020 T
NRXN1     AGRE_AU0614212chr2:
50463973-50463973
CTexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G395A
c.G3500A
c.G3620A
p.R132Q
p.R1167Q
p.R1207Q
33.01.657E-5Wang2020 T
NRXN1     AU079104chr2:
51819111-51819111
AGintergenicDe novo--Yuen2017 G
NRXN1     7-0160-003chr2:
51493127-51493127
AGintergenicDe novo--Yuen2017 G
NRXN1     TASC_217-14288-4090chr2:
50170866-50170867
AGAexonicDe novoframeshift deletionNM_138735
NM_004801
NM_001135659
c.996delC
c.4101delC
c.4311delC
p.P332fs
p.P1367fs
p.P1437fs
--Wang2020 T
NRXN1     2-1431-003chr2:
50906082-50906082
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NRXN1     SSC04927chr2:
50724605-50724605
ATexonicDe novostopgainNM_004801
NM_001135659
c.T2745A
c.T2865A
p.Y915X
p.Y955X
49.0-Antaki2022 GE
Fu2022 E
Lim2017 E
Trost2022 G
NRXN1     Leuven2_70845110chr2:
50758537-50758537
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2175A
c.G2295A
p.M725I
p.M765I
34.0-Wang2020 T
NRXN1     2-1431-003chr2:
50915714-50915714
GCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NRXN1     Leuven2_69532182chr2:
50779730-50779730
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1754A
c.G1874A
p.R585Q
p.R625Q
33.0-Wang2020 T
NRXN1     1-0531-003chr2:
52829160-52829160
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     Leuven_386431chr2:
50758537-50758537
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2175A
c.G2295A
p.M725I
p.M765I
34.0-Wang2020 T
NRXN1     Li2017:23778chr2:
50692611-50692611
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G3333A
c.G3453A
p.M1111I
p.M1151I
24.8-Li2017 T
NRXN1     2-1431-003chr2:
50937891-50937891
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NRXN1     1-0485-003chr2:
52606458-52606461
TACATAintergenicDe novo--Yuen2017 G
NRXN1     Leuven2_84840610chr2:
50779730-50779730
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1754A
c.G1874A
p.R585Q
p.R625Q
33.0-Wang2020 T
NRXN1     1-0184-003chr2:
51970389-51970406
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
NRXN1     1-0559-004chr2:
51353766-51353766
TAintergenicDe novo--Yuen2017 G
NRXN1     2-0264-004chr2:
51285668-51285668
CAintergenicDe novo--Yuen2017 G
NRXN1     AU4176302chr2:
52665542-52665542
GCintergenicDe novo--Yuen2017 G
NRXN1     7-0254-004chr2:
52853682-52853682
GAintergenicDe novo--Yuen2017 G
NRXN1     1-0572-003chr2:
50490235-50490235
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     5-0140-003chr2:
50965472-50965472
TGintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     1-0265-003chr2:
52629760-52629760
GCintergenicDe novo--Yuen2017 G
NRXN1     2-0022-003chr2:
50306068-50306068
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     12060.p1chr2:
51259257-51259258
CGCUTR5De novo--Werling2018 G
Wilfert2021 G
NRXN1     AU075703chr2:
52388399-52388399
CTintergenicDe novo--Yuen2017 G
NRXN1     iHART1890chr2:
50780064-50780064
CAexonicPaternalstopgainNM_004801
NM_001135659
c.G1420T
c.G1540T
p.E474X
p.E514X
49.0-Ruzzo2019 G
NRXN1     2-1244-003chr2:
52211719-52211719
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     2-1244-003chr2:
52723344-52723344
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     iHART1889chr2:
50780064-50780064
CAexonicPaternalstopgainNM_004801
NM_001135659
c.G1420T
c.G1540T
p.E474X
p.E514X
49.0-Ruzzo2019 G
NRXN1     2-1620-004chr2:
51089213-51089213
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     2-1207-003chr2:
52690587-52690587
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     B8Z4Fchr2:
50692579-50692579
CTsplicingInheritedsplicing22.5-Stessman2017 T
NRXN1     AU3964302chr2:
50497740-50497740
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     1-0144-004chr2:
51365245-51365245
AGintergenicDe novo--Yuen2017 G
NRXN1     2-1460-003chr2:
51947621-51947621
TCintergenicDe novo--Yuen2017 G
NRXN1     1-0465-003chr2:
52058679-52058679
CTintergenicDe novo--Yuen2017 G
NRXN1     AU4235301chr2:
52477997-52477997
TCintergenicDe novo--Yuen2017 G
NRXN1     12501.p1chr2:
50724605-50724605
ATexonicDe novostopgainNM_004801
NM_001135659
c.T2745A
c.T2865A
p.Y915X
p.Y955X
49.0-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lowther2023 G
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
NRXN1     AU3724301chr2:
50450690-50450690
CTintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     2-1440-003chr2:
51925281-51925281
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     A31chr2:
50870593-50870593
CGintronicDe novo--Wu2018 G
NRXN1     AU3786301chr2:
51009138-51009138
GAintronicDe novo--Yuen2017 G
NRXN1     AU2951303chr2:
50817801-50817801
CTintronicDe novo--Yuen2017 G
NRXN1     2-1406-003chr2:
51689092-51689092
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     1-0279-004chr2:
50635125-50635125
AGintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     5-0004-003chr2:
52673928-52673928
GTintergenicDe novo--Yuen2017 G
NRXN1     ACGC_SX0014.p1chr2:
50758478-50758478
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2234A
c.G2354A
p.R745Q
p.R785Q
36.0-Wang2020 T
NRXN1     ACGC_M26820chr2:
50733677-50733677
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2453A
c.G2573A
p.G818E
p.G858E
33.0-Wang2020 T
NRXN1     AU3680301chr2:
50683158-50683158
AGintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     AU3858302chr2:
51378469-51378469
CTintergenicDe novo--Yuen2017 G
NRXN1     M23715chr2:
50724685-50724685
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2665A
c.G2785A
p.D889N
p.D929N
35.0-Guo2018 T
Wang2016 T
NRXN1     ACGC_M27891chr2:
50699492-50699492
GAexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.C3188T
c.C3308T
p.P1063L
p.P1103L
33.08.42E-6Wang2020 T
NRXN1     1-0452-003chr2:
52302220-52302220
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     ACGC_M26879chr2:
50723214-50723215
CACexonicMaternalframeshift deletionNM_004801
NM_001135659
c.2898delT
c.3018delT
p.F966fs
p.F1006fs
--Wang2020 T
NRXN1     2-1451-004chr2:
50345418-50345418
TCintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     217-14288-4090 Complex Event; expand row to view variants  De novoframeshift deletionNM_138735
NM_004801
NM_001135659
NM_138735
NM_004801
NM_001135659
c.996delC
c.4101delC
c.4311delC
c.995delC
c.4100delC
c.4310delC
p.P332fs
p.P1367fs
p.P1437fs
p.P332fs
p.P1367fs
p.P1437fs
--O’Roak2014 T
Stessman2017 T
Stessman2017 T
NRXN1     1-0901-003chr2:
52338673-52338673
CGintergenicDe novo--Yuen2017 G
NRXN1     2-0022-004chr2:
50678167-50678167
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     74-0352chr2:
52580360-52580360
ATintergenicDe novo--Michaelson2012 G
NRXN1     2-1297-004chr2:
51083088-51083088
TCintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     AU3154302chr2:
52160245-52160245
AGintergenicDe novo--Yuen2017 G
NRXN1     2-1497-003chr2:
50656695-50656695
AGintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     AU002406chr2:
52179326-52179326
TCintergenicDe novo--Yuen2017 G
NRXN1     M26820chr2:
50733677-50733677
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2453A
c.G2573A
p.G818E
p.G858E
33.0-Guo2018 T
Wang2016 T
NRXN1     1-0559-005chr2:
50318312-50318312
CGintronicDe novo--Yuen2017 G
NRXN1     1-0339-004chr2:
51843463-51843463
AGintergenicDe novo--Yuen2017 G
NRXN1     3-0431-000chr2:
52126740-52126740
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     AU3702307chr2:
51973646-51973646
TAintergenicDe novo--Yuen2017 G
NRXN1     AU4228302chr2:
50162790-50162790
CAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     1-0265-004chr2:
52629760-52629760
GCintergenicDe novo--Yuen2017 G
NRXN1     2-1343-003chr2:
50801767-50801767
CAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NRXN1     1-0402-004chr2:
51153293-51153293
GCintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     1-0465-003achr2:
52058679-52058679
CTintergenicDe novo--Yuen2017 G
NRXN1     138chr2:
50280477-50280477
TAexonicPaternalnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.A865T
c.A3970T
c.A4180T
p.T289S
p.T1324S
p.T1394S
20.22.0E-4Wen2017 E
NRXN1     A1chr2:
52516954-52516954
CAintergenicDe novo--Wu2018 G
NRXN1     7-0143-003chr2:
50638627-50638627
CGintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     M02443chr2:
50724685-50724685
CTexonicPaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2665A
c.G2785A
p.D889N
p.D929N
35.0-Guo2018 T
Wang2016 T
NRXN1     3-0434-000chr2:
51932157-51932157
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     2-1507-003chr2:
50386109-50386109
CTintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     SSC06079chr2:
50699435-50699435
CAsplicingMaternalsplicing24.8-Chan2022 G
NRXN1     AU2863303chr2:
51512074-51512074
AGintergenicDe novo--Yuen2017 G
NRXN1     2-1066-004chr2:
51551133-51551133
ATintergenicDe novo--Yuen2017 G
NRXN1     SF0069869.p1chr2:
50780046-50780046
CGexonicnonsynonymous SNVNM_004801
NM_001135659
c.G1438C
c.G1558C
p.D480H
p.D520H
24.7-Wang2020 T
NRXN1     SF0140821.p1chr2:
50779753-50779753
ACexonicnonsynonymous SNVNM_004801
NM_001135659
c.T1731G
c.T1851G
p.H577Q
p.H617Q
17.47-Wang2020 T
NRXN1     2-1315-003chr2:
51585814-51585814
CTintergenicDe novo--Yuen2017 G
NRXN1     2-1116-003chr2:
50724817-50724817
GAexonicInheritednonsynonymous SNVNM_004801
NM_001135659
c.C2533T
c.C2653T
p.H845Y
p.H885Y
32.06.0E-4Jiang2013 G
NRXN1     7-0248-003chr2:
51371191-51371191
GCintergenicDe novo--Yuen2017 G
NRXN1     AU1988301chr2:
51128158-51128158
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     2-1352-003chr2:
51797440-51797440
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     AU2089302chr2:
52928210-52928210
TCintergenicDe novo--Yuen2017 G
NRXN1     1-0565-004chr2:
51476580-51476580
TAintergenicDe novo--Yuen2017 G
NRXN1     AU4243302chr2:
51473877-51473877
GCintergenicDe novo--Yuen2017 G
NRXN1     13557.p1chr2:
50562721-50562721
GAintronicDe novo--Wilfert2021 G
NRXN1     M26879 Complex Event; expand row to view variants  Maternalframeshift substitution, frameshift deletionNM_004801
NM_001135659
NM_004801
NM_001135659
c.2898delT
c.3018delT
c.2898_2899A
c.3018_3019A
p.F966fs
p.F1006fs
N/A
N/A
--Guo2018 T
Wang2016 T
NRXN1     2-1170-003chr2:
51215643-51215643
CTintronicDe novo--Yuen2017 G
NRXN1     1-0565-004chr2:
52409700-52409700
TTGTAAintergenicDe novo--Yuen2017 G
NRXN1     2-0102-003chr2:
52170820-52170820
GTintergenicDe novo--Yuen2017 G
NRXN1     AU4231301chr2:
51724931-51724931
AGintergenicDe novo--Yuen2017 G
NRXN1     1-0226-005chr2:
52687953-52687953
AGintergenicDe novo--Yuen2017 G
NRXN1     11474.p1chr2:
50703434-50703434
AGintronicDe novo--Wilfert2021 G
NRXN1     13823.p1chr2:
50624886-50624886
ACintronicDe novo--Wilfert2021 G
NRXN1     1-0609-003chr2:
50864033-50864033
TCintronicDe novo--Yuen2017 G
NRXN1     12799.p1chr2:
52886862-52886866
TTGCAGTGCCintergenicMaternal--Wilfert2021 G
NRXN1     1-0277-003chr2:
51514052-51514052
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     AU3632301chr2:
52839347-52839347
TCintergenicDe novo--Yuen2017 G
NRXN1     08C73161chr2:
51254748-51254748
CAexonicDe novostopgainNM_001135659
NM_004801
c.G664T
c.G664T
p.E222X
p.E222X
47.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
NRXN1     AU031203chr2:
52601722-52601729
AAAAGAAAAAAAintergenicDe novo--Yuen2017 G
NRXN1     7-0077-003chr2:
50919107-50919107
TAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     AU030103chr2:
51972268-51972268
AGintergenicDe novo--Yuen2017 G
NRXN1     7-0055-003chr2:
52078634-52078634
CTintergenicDe novo--Yuen2017 G
NRXN1     7-0055-003chr2:
52078636-52078636
AGintergenicDe novo--Yuen2017 G
NRXN1     AU4269301chr2:
50606609-50606609
CTintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     1-0534-003chr2:
50969632-50969632
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     DEASD_0107_001chr2:
50318536-50318536
CTexonicDe novo, Unknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G538A
c.G3643A
c.G3763A
p.V180I
p.V1215I
p.V1255I
20.1-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
NRXN1     NDAR_INVCG000TG1_wes1chr2:
50850511-50850511
TGexonicDe novo, Unknownnonsynonymous SNVNM_004801
NM_001135659
c.A1075C
c.A1174C
p.N359H
p.N392H
18.45-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
NRXN1     2-0135-004chr2:
50813838-50813838
GAintronicDe novo--Yuen2017 G
NRXN1     AU3703302chr2:
52787724-52787724
TCintergenicDe novo--Yuen2017 G
NRXN1     2-1508-003chr2:
52739191-52739191
TAintergenicDe novo--Yuen2017 G
NRXN1     5-5162-003chr2:
50212700-50212700
CGintronicDe novo--Trost2022 G
NRXN1     MSSNG00256-005chr2:
50212353-50212353
TGintronicDe novo--Trost2022 G
NRXN1     7-0337-004chr2:
50283433-50283433
TCintronicDe novo--Trost2022 G
NRXN1     2-1659-003chr2:
50232082-50232082
CTintronicDe novo--Trost2022 G
NRXN1     REACH000380chr2:
50167567-50167572
GTTATAGintronicDe novo--Trost2022 G
NRXN1     1-1063-004chr2:
50154631-50154631
CGintronicDe novo--Trost2022 G
NRXN1     1-0760-004chr2:
50207063-50207063
GTintronicDe novo--Trost2022 G
NRXN1     AU3052302chr2:
50514188-50514188
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     7-0458-003chr2:
50197595-50197595
AGintronicDe novo--Trost2022 G
NRXN1     7-0266-003chr2:
50413872-50413872
CTintronicDe novo--Trost2022 G
NRXN1     MSSNG00035-004chr2:
50392069-50392069
ATintronicDe novo--Trost2022 G
NRXN1     2-1514-003chr2:
50174759-50174759
CTintronicDe novo--Yuen2017 G
NRXN1     TASC_210-18164-301chr2:
50149217-50149217
GCexonicUnknownstopgainNM_138735
NM_004801
NM_001135659
c.C1194G
c.C4299G
c.C4509G
p.Y398X
p.Y1433X
p.Y1503X
49.0-Wang2020 T
NRXN1     AU059003chr2:
50419525-50419525
TGintronicDe novo--Trost2022 G
NRXN1     AGRE_AU2054301chr2:
50149217-50149217
GCexonicUnknownstopgainNM_138735
NM_004801
NM_001135659
c.C1194G
c.C4299G
c.C4509G
p.Y398X
p.Y1433X
p.Y1503X
49.0-Wang2020 T
NRXN1     7-0011-003chr2:
50417880-50417880
AGintronicDe novo--Trost2022 G
NRXN1     1-0445-003chr2:
52314858-52314858
ACintergenicDe novo--Yuen2017 G
NRXN1     MSSNG00128-003chr2:
50338137-50338137
CAintronicDe novo--Trost2022 G
NRXN1     7-0168-003chr2:
51212586-51212586
GCintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     AU1988302chr2:
51128158-51128158
GAintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     MSSNG00171-003chr2:
50287556-50287556
CTintronicDe novo--Trost2022 G
NRXN1     AU113Achr2:
50464119-50464119
AGintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
NRXN1     TASC_211-5211-3chr2:
50464021-50464021
CAexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G347T
c.G3452T
c.G3572T
p.R116I
p.R1151I
p.R1191I
35.0-Wang2020 T
NRXN1     5-5014-003chr2:
50353294-50353294
GAintronicDe novo--Trost2022 G
NRXN1     2-1283-003chr2:
52385545-52385545
TAintergenicDe novo--Yuen2017 G
NRXN1     M02013chr2:
50733692-50733692
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2438A
c.G2558A
p.R813H
p.R853H
30.04.247E-5Guo2018 T
NRXN1     1-1129-003chr2:
50343181-50343181
TGintronicDe novo--Trost2022 G
NRXN1     2-1365-003chr2:
51590470-51590470
TGintergenicDe novo--Yuen2017 G
NRXN1     5-0014-004chr2:
51902017-51902017
GTintergenicDe novo--Yuen2017 G
NRXN1     AU2320301chr2:
50487393-50487393
CAintronicDe novo--Trost2022 G
NRXN1     AU3885304chr2:
51652073-51652073
CTintergenicDe novo--Yuen2017 G
NRXN1     MSSNG00247-003chr2:
50474645-50474645
CAintronicDe novo--Trost2022 G
NRXN1     REACH000564chr2:
50507808-50507808
TCintronicDe novo--Trost2022 G
NRXN1     5-0009-003chr2:
50496970-50496970
GAintronicDe novo--Trost2022 G
NRXN1     1-0193-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NRXN1     5-0033-004chr2:
51951889-51951889
CGintergenicDe novo--Yuen2017 G
NRXN1     C9C2C_01chr2:
50455796-50455796
CTintronicDe novo--Trost2022 G
NRXN1     REACH000171chr2:
50466864-50466864
ATintronicDe novo--Trost2022 G
NRXN1     REACH000171chr2:
50466862-50466862
GTintronicDe novo--Trost2022 G
NRXN1     7-0389-003chr2:
50587907-50587907
GAintronicDe novo--Trost2022 G
NRXN1     REACH000653chr2:
50560895-50560895
ACintronicDe novo--Trost2022 G
NRXN1     2-0238-003chr2:
51015982-51015982
ACintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     2-0143-004chr2:
50602626-50602629
GTTTCCCGGCCintronicDe novo--Trost2022 G
NRXN1     7-0202-003chr2:
50602625-50602629
TGTTTCGGCCintronicDe novo--Trost2022 G
NRXN1     7-0249-003chr2:
52730495-52730495
GAintergenicDe novo--Yuen2017 G
NRXN1     1-0098-003Achr2:
50534379-50534379
CCAAintronicDe novo--Trost2022 G
NRXN1     7-0333-003chr2:
50530937-50530937
AATintronicDe novo--Trost2022 G
NRXN1     3-0604-000chr2:
50550215-50550215
ACintronicDe novo--Trost2022 G
NRXN1     2-1723-003chr2:
50547289-50547291
TCAATTintronicDe novo--Trost2022 G
NRXN1     1-1159-003chr2:
50632431-50632431
CTintronicDe novo--Trost2022 G
NRXN1     REACH000198chr2:
50625593-50625593
AGintronicDe novo--Trost2022 G
NRXN1     AU3905301chr2:
52187103-52187103
CTintergenicDe novo--Yuen2017 G
NRXN1     AU046506chr2:
50696310-50696310
TTGintronicDe novo--Trost2022 G
NRXN1     Li2017:18488chr2:
50765424-50765424
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2110A
c.G2230A
p.G704R
p.G744R
29.31.0E-4Li2017 T
NRXN1     MSSNG00346-004chr2:
50696191-50696192
TATintronicDe novo--Trost2022 G
NRXN1     MSSNG00042-004chr2:
50606122-50606122
AGintronicDe novo--Trost2022 G
NRXN1     4-0040-004chr2:
50602626-50602629
GTTTCCCGGCCintronicDe novo--Trost2022 G
NRXN1     5-5231-003chr2:
50617404-50617404
ACintronicDe novo--Trost2022 G
NRXN1     1-0336-004chr2:
51165561-51165561
CTintronicDe novo--Trost2022 G
Yuen2017 G
NRXN1     5-1012-003chr2:
50611289-50611289
GTintronicDe novo--Trost2022 G
NRXN1     AU4215302chr2:
52364131-52364131
AGintergenicDe novo--Yuen2017 G
NRXN1     AU3807302chr2:
50806800-50806800
AATintronicDe novo--Trost2022 G
NRXN1     REACH000602chr2:
50782721-50782721
CTintronicDe novo--Trost2022 G
NRXN1     1033chr2:
50846198-50846198
TCintronicDe novo--Trost2022 G
NRXN1     MSSNG00007-003Achr2:
50823714-50823714
GAintronicDe novo--Trost2022 G
NRXN1     M27891chr2:
50699492-50699492
GAexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.C3188T
c.C3308T
p.P1063L
p.P1103L
33.08.42E-6Guo2018 T
Wang2016 T
NRXN1     SP0112775chr2:
50724785-50724785
TCexonicDe novosynonymous SNVNM_004801
NM_001135659
c.A2565G
c.A2685G
p.R855R
p.R895R
--Trost2022 G
NRXN1     2-1692-003chr2:
50706846-50706846
AAGCAATAATintronicDe novo--Trost2022 G
NRXN1     3-0116-001chr2:
50766333-50766333
GAintronicDe novo--Trost2022 G
NRXN1     5-0038-003chr2:
50760392-50760392
AGintronicDe novo--Trost2022 G
NRXN1     MT_154.3chr2:
50940495-50940495
CAintronicDe novo--Trost2022 G
NRXN1     MT_183.4chr2:
50927208-50927208
TCintronicDe novo--Trost2022 G
NRXN1     1-0180-004chr2:
50952093-50952095
GGCCGTintronicDe novo--Trost2022 G
NRXN1     4-0061-003chr2:
50952090-50952090
GTintronicDe novo--Trost2022 G
NRXN1     AU071804chr2:
52578751-52578751
CGintergenicDe novo--Yuen2017 G
NRXN1     3-0278-000chr2:
50890210-50890210
GTintronicDe novo--Trost2022 G
NRXN1     JASD_Fam0198chr2:
51255348-51255348
CGexonicDe novononsynonymous SNVNM_001135659
NM_004801
c.G64C
c.G64C
p.G22R
p.G22R
17.59-Takata2018 E
NRXN1     5-0043-003chr2:
50888616-50888616
GAintronicDe novo--Trost2022 G
NRXN1     1-1130-003chr2:
50917426-50917426
TCintronicDe novo