or
or
Exact

Results for "CADPS"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CADPS     AU3517302chr3:
63032029-63032029
GAintergenicDe novo--Yuen2017 G
CADPS     1-0059-003chr3:
62693443-62693443
AGintronicDe novo--Yuen2017 G
CADPS     AU4246304 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CADPS     7-0191-003chr3:
62623298-62623298
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     1-0487-003chr3:
62650766-62650766
TAintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     2-1721-003chr3:
62588056-62588056
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     1-0162-004chr3:
62515651-62515651
TCintronicDe novo--Yuen2017 G
CADPS     1-0834-003chr3:
62465522-62465522
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     EGAN00001100990chr3:
62860603-62860603
AGexonicDe novosynonymous SNVNM_003716
NM_183393
NM_183394
c.T102C
c.T102C
c.T102C
p.S34S
p.S34S
p.S34S
-2.0E-4Fu2022 E
CADPS     2-0318-004chr3:
62510700-62510700
TGintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     2-0503-004chr3:
62811387-62811387
CAintronicDe novo--Yuen2017 G
CADPS     1-0138-003chr3:
63056140-63056155
TTTACTCCAACTGACCTintergenicDe novo--Yuen2017 G
CADPS     AU3712301chr3:
62394006-62394006
GTintronicDe novo--Yuen2017 G
CADPS     AU4356302chr3:
62605943-62605943
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     1-0073-003chr3:
63077740-63077740
CTintergenicDe novo--Yuen2017 G
CADPS     SP0066135chr3:
62501760-62501760
CTexonicDe novononsynonymous SNVNM_003716
NM_183393
NM_183394
c.G2555A
c.G2504A
c.G2555A
p.R852Q
p.R835Q
p.R852Q
18.141.651E-5Fu2022 E
Trost2022 G
Zhou2022 GE
CADPS     SP0126962chr3:
62388796-62388796
AGexonicDe novononsynonymous SNVNM_183393
NM_183394
NM_003716
c.T3605C
c.T3725C
c.T3842C
p.L1202P
p.L1242P
p.L1281P
23.8-Fu2022 E
Trost2022 G
Zhou2022 GE
CADPS     7-0077-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CADPS     SP0040514chr3:
62423748-62423753
GGTTTTGintronicDe novo--Fu2022 E
CADPS     1-0051-005chr3:
62752113-62752113
CAintronicDe novo--Yuen2017 G
CADPS     AU4145303chr3:
62598324-62598324
GTintronicDe novo--Yuen2017 G
CADPS     7-0127-003chr3:
62883737-62883737
AAAATCintergenicDe novo--Yuen2017 G
CADPS     1-0582-003chr3:
62503468-62503468
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     MSSNG00329-003chr3:
62516674-62516674
TGintronicDe novo--Trost2022 G
CADPS     REACH000327chr3:
62525466-62525466
AGintronicDe novo--Trost2022 G
CADPS     AU2572301chr3:
62488892-62488892
AGintronicDe novo--Trost2022 G
CADPS     4-0111-003chr3:
62491001-62491001
GCintronicDe novo--Trost2022 G
CADPS     AU078503chr3:
62442038-62442038
GGAintronicDe novo--Trost2022 G
CADPS     REACH000198chr3:
62480379-62480379
GTintronicDe novo--Trost2022 G
CADPS     1-1184-003chr3:
62400154-62400154
TCintronicDe novo--Trost2022 G
CADPS     1-0045-004chr3:
62680241-62680241
ATintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     1-0864-003chr3:
62422711-62422711
TCintronicDe novo--Trost2022 G
CADPS     3-0829-000chr3:
62628049-62628049
AGintronicDe novo--Trost2022 G
CADPS     1-0806-003chr3:
62664607-62664607
GTintronicDe novo--Yuen2017 G
CADPS     AU3997302chr3:
62732349-62732349
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     2-1749-003chr3:
62669007-62669007
GAintronicDe novo--Trost2022 G
CADPS     AU3997302chr3:
62739541-62739541
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     1-0203-004chr3:
62608005-62608005
GGAACAAGACCGCAGGGAACintronicDe novo--Trost2022 G
CADPS     1-0207-005chr3:
62618685-62618685
ATintronicDe novo--Trost2022 G
CADPS     REACH000145chr3:
62562509-62562509
GAintronicDe novo--Trost2022 G
CADPS     AU3721302chr3:
62750422-62750422
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     1-0203-004chr3:
62608002-62608002
GCCCCAGCACCAAintronicDe novo--Trost2022 G
CADPS     2-1153-003chr3:
63027978-63027978
GAintergenicDe novo--Yuen2017 G
CADPS     REACH000239chr3:
62546213-62546213
CTintronicDe novo--Trost2022 G
CADPS     1-0630-003chr3:
62548133-62548133
GCintronicDe novo--Trost2022 G
CADPS     1-0400-003chr3:
62498954-62498954
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CADPS     5-0045-003chr3:
62818077-62818077
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     09C97625chr3:
62543117-62543117
CTexonicDe novosynonymous SNVNM_003716
NM_183393
NM_183394
c.G1716A
c.G1716A
c.G1716A
p.L572L
p.L572L
p.L572L
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CADPS     AU2310301chr3:
62815974-62815974
CTintronicDe novo--Trost2022 G
CADPS     2-1410-003chr3:
62851014-62851014
CTintronicDe novo--Trost2022 G
CADPS     MSSNG00354-003chr3:
62701124-62701127
CATTCintronicDe novo--Trost2022 G
CADPS     5-5149-003chr3:
62796467-62796467
GAintronicDe novo--Trost2022 G
CADPS     14482.p1chr3:
62480373-62480373
GTintronicDe novo--Turner2016 G
CADPS     12493.p1chr3:
62921691-62921691
CTintergenicDe novo--Turner2016 G
CADPS     1-0965-003chr3:
62801232-62801232
TCintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     A2chr3:
62876136-62876136
GAintergenicDe novo--Wu2018 G
CADPS     14496.p1chr3:
63026369-63026369
CTintergenicDe novo--Turner2016 G
CADPS     5-0055-003chr3:
62669144-62669144
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADPS     2-1729-003chr3:
62988660-62988660
CAintergenicDe novo--Yuen2017 G
CADPS     08C72640chr3:
62536525-62536525
AGintronicDe novo6.126-Satterstrom2020 E
Trost2022 G
CADPS     AU4476302chr3:
62475514-62475514
TCintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More