or
or
Exact

Results for "INTU"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
INTU     1-1210-003chr4:
128591279-128591279
ATintronicDe novo--Trost2022 G
INTU     1-1154-003chr4:
128577338-128577338
CTintronicDe novo--Trost2022 G
INTU     MSSNG00184-003chr4:
128580784-128580784
ATintronicDe novo--Trost2022 G
INTU     2-1266-003chr4:
128637320-128637320
AGintronicDe novo--Yuen2016 G
Yuen2017 G
INTU     7-0151-003chr4:
128574961-128574961
AGintronicDe novo--Yuen2017 G
INTU     iHART1908chr4:
128564998-128564998
CTexonicMaternalstopgainNM_015693c.C469Tp.R157X15.014.12E-5Ruzzo2019 G
INTU     2-1460-003chr4:
128605836-128605836
AGintronicDe novo--Yuen2017 G
INTU     AU4327303chr4:
128571669-128571677
TCCAATTTCTCCAATTTCCCAATTTCintronicDe novo--Yuen2017 G
INTU     09C81661chr4:
128595288-128595288
CTexonicDe novosynonymous SNVNM_015693c.C1101Tp.L367L--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
INTU     1-0300-004chr4:
128595213-128595219
ATTATACAintronicDe novo--Trost2022 G
Yuen2017 G
INTU     SP0078568chr4:
128564762-128564762
TCexonicnonsynonymous SNVNM_015693c.T233Cp.L78P17.142.474E-5Zhou2022 GE
INTU     mAGRE1908chr4:
128564998-128564998
CTexonicMaternalstopgainNM_015693c.C469Tp.R157X15.014.12E-5Cirnigliaro2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More