or
or
Exact

Results for "AXDND1"

Variant Events: 44

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AXDND1     1-0559-003chr1:
179448244-179448244
TTAACACAAAAGTAACTAACTAAATAAintronicDe novo--Trost2022 G
AXDND1     2-1715-004chr1:
179448239-179448239
AATintronicDe novo--Trost2022 G
AXDND1     4-0054-003chr1:
179448878-179448881
CTTTACCCintronicDe novo--Trost2022 G
AXDND1     4-0040-003chr1:
179448249-179448249
AACACAAAAGTAACTAACintronicDe novo--Trost2022 G
AXDND1     1-0321-004chr1:
179448233-179448233
TACintronicDe novo--Trost2022 G
AXDND1     2-1456-004chr1:
179448241-179448241
AAAGTintronicDe novo--Yuen2017 G
AXDND1     1-0323-004chr1:
179448229-179448235
TCTGTCTAAACAGATAAATAAATAAAATAACAintronicDe novo--Trost2022 G
AXDND1     A28chr1:
179502994-179502994
AGexonicDe novononsynonymous SNVNM_144696c.A2780Gp.H927R5.1962.474E-5Wu2018 G
AXDND1     2-1349-003chr1:
179448239-179448239
AACAGATAAATAAATintronicDe novo--Trost2022 G
AXDND1     3-0198-000chr1:
179448233-179448235
TCTGCAAAAACGAAintronicDe novo--Trost2022 G
AXDND1     MT_44.3chr1:
179516865-179516865
TCintronicDe novo--Trost2022 G
AXDND1     SP0179792chr1:
179497570-179497570
TGintronicDe novo--Trost2022 G
AXDND1     AU009805chr1:
179359858-179359858
CTintronicDe novo--Trost2022 G
Yuen2017 G
AXDND1     AU071204chr1:
179384909-179384909
TGintronicDe novo--Trost2022 G
Yuen2017 G
AXDND1     3-0099-000chr1:
179518454-179518454
GAintronicDe novo--Trost2022 G
AXDND1     SP0022858chr1:
179497570-179497570
TGintronicDe novo--Trost2022 G
AXDND1     SP0035464chr1:
179497570-179497570
TGintronicDe novo--Trost2022 G
AXDND1     SP0165766chr1:
179497570-179497570
TGintronicDe novo--Trost2022 G
AXDND1     SP0145909chr1:
179497570-179497570
TGintronicDe novo--Trost2022 G
AXDND1     2-1350-003chr1:
179448337-179448337
TCintronicDe novo--Yuen2017 G
AXDND1     1-0210-004chr1:
179375853-179375853
TCintronicDe novo--Trost2022 G
Yuen2017 G
AXDND1     06C55684Achr1:
179337957-179337957
AGexonicDe novosynonymous SNVNM_144696c.A120Gp.K40K--Neale2012 E
AXDND1     2-1306-003chr1:
179448247-179448247
TTAATAAAATAAATAAATAAAATAACACAAAAGTAACTAACTAintronicDe novo--Yuen2017 G
AXDND1     2-1526-004chr1:
179448240-179448240
AAACGAACAAACAGATintronicDe novo--Yuen2017 G
AXDND1     2-0289-003chr1:
179448356-179448356
ACintronicDe novo--Yuen2017 G
AXDND1     09C98975chr1:
179398643-179398643
ATintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
AXDND1     2-1485-003chr1:
179448340-179448340
AGintronicDe novo--Yuen2017 G
AXDND1     1-0955-003chr1:
179352313-179352313
AGintronicDe novo--Trost2022 G
AXDND1     mAGRE5176chr1:
179414116-179414117
GAGexonicMaternalframeshift deletionNM_144696c.1576delAp.K526fs--Cirnigliaro2023 G
AXDND1     mAGRE2844chr1:
179354495-179354495
GTsplicingMaternalsplicing24.72.0E-4Cirnigliaro2023 G
AXDND1     mAGRE1866chr1:
179354495-179354495
GTsplicingMaternalsplicing24.72.0E-4Cirnigliaro2023 G
AXDND1     2-1322-003chr1:
179373081-179373081
ACintronicDe novo--Trost2022 G
Yuen2017 G
AXDND1     AU2495302chr1:
179339118-179339119
TCTexonicPaternalframeshift deletionNM_144696c.280delCp.P94fs--Cirnigliaro2023 G
AXDND1     AU2495301chr1:
179339118-179339119
TCTexonicPaternalframeshift deletionNM_144696c.280delCp.P94fs--Cirnigliaro2023 G
AXDND1     SP0195902chr1:
179414116-179414116
GGAexonicDe novoframeshift insertionNM_144696c.1576dupAp.E525fs--Trost2022 G
AXDND1     AU055603chr1:
179413768-179413768
TGintronicDe novo--Trost2022 G
AXDND1     REACH000258chr1:
179440128-179440128
CGintronicDe novo--Trost2022 G
AXDND1     1-1102-003chr1:
179416680-179416680
AGintronicDe novo--Trost2022 G
AXDND1     AU071204chr1:
179384900-179384900
CTintronicDe novo--Trost2022 G
AXDND1     2-1506-003chr1:
179343494-179343494
GAintronicDe novo--Trost2022 G
Yuen2017 G
AXDND1     1-1112-003chr1:
179358305-179358305
AGintronicDe novo--Trost2022 G
AXDND1     AU3371302chr1:
179488266-179488266
CTintronicDe novo--Trost2022 G
Yuen2017 G
AXDND1     REACH000586chr1:
179396967-179396967
CGintronicDe novo--Trost2022 G
AXDND1     AU071204chr1:
179384914-179384914
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More