or
or
Exact

Results for "URB2"

Variant Events: 49

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
URB2     1-0539-003chr1:
230107682-230107682
CCACATACGCATintergenicDe novo--Yuen2017 G
URB2     2-1182-003chr1:
230163908-230163908
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
URB2     7-0002-003chr1:
229825068-229825068
TGintergenicDe novo--Yuen2017 G
URB2     1-0339-003chr1:
230119217-230119217
TGintergenicDe novo--Yuen2017 G
URB2     Uddin2014:55chr1:
229783350-229783350
GTexonicDe novostopgainNM_001314021
NM_014777
c.G4000T
c.G4000T
p.E1334X
p.E1334X
44.0-Uddin2014 E
URB2     1-0458-003chr1:
230001621-230001621
CTintergenicDe novo--Yuen2017 G
URB2     1-0551-003chr1:
229792468-229792468
GCintronicDe novo--Trost2022 G
Yuen2017 G
URB2     AU031204chr1:
229900546-229900546
GTintergenicDe novo--Yuen2017 G
URB2     5-0111-003chr1:
230044597-230044597
GAintergenicDe novo--Yuen2017 G
URB2     5-0051-003chr1:
229774858-229774858
AGintronicDe novo--Trost2022 G
URB2     AU3858303chr1:
229969123-229969125
TCCTCintergenicDe novo--Yuen2017 G
URB2     SP0144133chr1:
229770779-229770779
CTexonicDe novononsynonymous SNVNM_001314021
NM_014777
c.C419T
c.C419T
p.T140M
p.T140M
21.25.791E-5Trost2022 G
URB2     1-0595-005chr1:
230006726-230006727
ATAintergenicDe novo--Yuen2017 G
URB2     2-0198-004chr1:
230107705-230107716
CACCATGTACATCintergenicDe novo--Yuen2017 G
URB2     2-1335-004chr1:
230006665-230006665
TTACAACACACACACAACACACAACACACAACATATACACTCAACACACintergenicDe novo--Yuen2017 G
URB2     2-0208-003chr1:
229788284-229788284
CTintronicDe novo--Yuen2017 G
URB2     SP0094767chr1:
229772973-229772973
CGexonicDe novosynonymous SNVNM_001314021
NM_014777
c.C2613G
c.C2613G
p.A871A
p.A871A
--Fu2022 E
Trost2022 G
Zhou2022 GE
URB2     SP0118723chr1:
229770752-229770752
CTexonicDe novononsynonymous SNVNM_001314021
NM_014777
c.C392T
c.C392T
p.S131L
p.S131L
16.965.038E-5Fu2022 E
Trost2022 G
Zhou2022 GE
URB2     1-0043-003chr1:
230107705-230107716
CACCATGTACATCintergenicDe novo--Yuen2017 G
URB2     1-0405-003chr1:
230107682-230107682
CCACATACGCATintergenicDe novo--Yuen2017 G
URB2     DEASD_1110_001chr1:
229781580-229781580
GAintronicDe novo-8.243E-6Satterstrom2020 E
Trost2022 G
URB2     1-0554-003chr1:
230188226-230188226
CTintergenicDe novo--Yuen2017 G
URB2     2-0198-003chr1:
230107682-230107682
CCACATACGCATintergenicDe novo--Yuen2017 G
URB2     2-1644-003chr1:
230006730-230006730
AACATGintergenicDe novo--Yuen2017 G
URB2     AU048206chr1:
230029254-230029254
CTintergenicDe novo--Yuen2017 G
URB2     7-0130-003chr1:
230006719-230006719
CCAAintergenicDe novo--Yuen2017 G
URB2     AU069603chr1:
230019382-230019382
AGintergenicDe novo--Yuen2017 G
URB2     1-0403-003chr1:
229786910-229786910
TGintronicDe novo--Trost2022 G
Yuen2017 G
URB2     2-1252-003chr1:
230006540-230006540
GAintergenicDe novo--Yuen2017 G
URB2     2-0503-003chr1:
230107682-230107682
CCACATACGCATintergenicDe novo--Yuen2017 G
URB2     3-0134-000chr1:
230006781-230006781
CCATAACACAGGTGAAintergenicDe novo--Yuen2017 G
URB2     11341.p1chr1:
229987987-229987987
ATintergenicDe novo--Turner2016 G
URB2     AU3951301chr1:
230012103-230012103
CTintergenicDe novo--Yuen2017 G
URB2     2-1261-003chr1:
230006719-230006719
CCAAintergenicDe novo--Yuen2017 G
URB2     13942.p1chr1:
230032826-230032826
CTintergenicDe novo--Turner2016 G
URB2     mAGRE4646chr1:
229773100-229773102
CATCexonicPaternalframeshift deletionNM_001314021
NM_014777
c.2741_2742del
c.2741_2742del
p.H914fs
p.H914fs
-1.647E-5Cirnigliaro2023 G
URB2     2-0202-004chr1:
230107705-230107716
CACCATGTACATCintergenicDe novo--Yuen2017 G
URB2     2-1720-003chr1:
229810054-229810054
CAintergenicDe novo--Yuen2017 G
URB2     2-1343-003chr1:
229866089-229866089
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
URB2     1-0339-004chr1:
229879828-229879828
AGintergenicDe novo--Yuen2017 G
URB2     2-1174-006chr1:
230001621-230001621
CTintergenicDe novo--Yuen2017 G
URB2     2-1264-003chr1:
229874371-229874371
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
URB2     5-0055-003chr1:
230006746-230006746
AATAACintergenicDe novo--Yuen2017 G
URB2     2-1300-003chr1:
230072499-230072499
CTintergenicDe novo--Yuen2017 G
URB2     74-0265chr1:
230106544-230106544
ATintergenicDe novo--Michaelson2012 G
URB2     2-1690-003chr1:
230147157-230147157
GAintergenicDe novo--Yuen2017 G
URB2     2-1409-003chr1:
229766435-229766435
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
URB2     2-1339-003chr1:
229987728-229987728
GCintergenicDe novo--Yuen2017 G
URB2     1-0625-003chr1:
230006540-230006540
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More