or
or
Exact

Results for "CPZ"

Variant Events: 48

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CPZ     SP0100919chr4:
8605850-8605850
GAexonicnonsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.G611A
c.G644A
c.G233A
p.R204H
p.R215H
p.R78H
26.4-Zhou2022 GE
CPZ     1-0338-003chr4:
8611127-8611133
GGTTTATCACTCACintronicDe novo--Trost2022 G
CPZ     2-1416-003chr4:
8844518-8844518
CAintergenicDe novo--Yuen2017 G
CPZ     1-0338-003chr4:
8611147-8611148
CCACTCATTGACTTAintronicDe novo--Trost2022 G
CPZ     1-0458-003chr4:
8611071-8611072
TTCTCAintronicDe novo--Trost2022 G
CPZ     1-0057-003chr4:
8616182-8616182
TAexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.T1427A
c.T1460A
c.T1049A
p.L476H
p.L487H
p.L350H
10.969.923E-5Trost2022 G
Zhou2022 GE
CPZ     1-0338-003chr4:
8611116-8611119
TTTCACTTintronicDe novo--Trost2022 G
CPZ     1-0305-004chr4:
8611044-8611045
TTCCintronicDe novo--Trost2022 G
CPZ     3-0709-000chr4:
8611045-8611045
TCACTCATTTACTCATTCACCCintronicDe novo--Trost2022 G
CPZ     MSSNG00109-003chr4:
8595627-8595627
GTintronicDe novo--Trost2022 G
CPZ     1-0285-004chr4:
8611039-8611040
TGCTCCCTintronicDe novo--Trost2022 G
CPZ     AU3782303chr4:
8607844-8607844
CCTexonicPaternalframeshift insertionNM_003652
NM_001014447
NM_001014448
c.806dupT
c.839dupT
c.428dupT
p.L269fs
p.L280fs
p.L143fs
-1.0E-4Cirnigliaro2023 G
CPZ     AU4024303chr4:
8636749-8636749
GAintergenicDe novo--Yuen2017 G
CPZ     SP0032857chr4:
8608658-8608658
CGintronicDe novo--Fu2022 E
Trost2022 G
CPZ     AU4033305chr4:
8623091-8623091
CTintergenicDe novo--Yuen2017 G
CPZ     SP0022019chr4:
8621093-8621093
CTexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.C1675T
c.C1708T
c.C1297T
p.R559W
p.R570W
p.R433W
15.861.658E-5Fu2022 E
Trost2022 G
Zhou2022 GE
CPZ     SP0089805chr4:
8621228-8621228
GAexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.G1810A
c.G1843A
c.G1432A
p.E604K
p.E615K
p.E478K
9.4898.669E-6Trost2022 G
CPZ     Cukier2014:37232chr4:
8613762-8613762
GTexonicUnknownnonsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.G1203T
c.G1236T
c.G825T
p.K401N
p.K412N
p.K275N
15.830.006Cukier2014 E
CPZ     1-0246-004chr4:
8610791-8610791
CCATintronicDe novo--Yuen2017 G
CPZ     1-0417-003chr4:
8823698-8823698
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CPZ     2-0144-003chr4:
8656233-8656233
ATintergenicDe novo--Yuen2017 G
CPZ     AU2381302chr4:
8843293-8843293
GAintergenicDe novo--Yuen2017 G
CPZ     2-1620-004chr4:
8662378-8662378
CCGGAintergenicDe novo--Yuen2017 G
CPZ     Uddin2014:3chr4:
8620162-8620162
CTexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.C1477T
c.C1510T
c.C1099T
p.R493W
p.R504W
p.R367W
14.454.126E-5Uddin2014 E
CPZ     2-0129-005chr4:
8741974-8741974
CAintergenicDe novo--Yuen2017 G
CPZ     2-0210-004chr4:
8610791-8610791
CCATintronicDe novo--Yuen2017 G
CPZ     SP0020948chr4:
8621112-8621112
GAexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.G1694A
c.G1727A
c.G1316A
p.R565H
p.R576H
p.R439H
33.04.0E-4Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
CPZ     1-0046-003chr4:
8763298-8763298
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CPZ     2-0296-004chr4:
8610759-8610759
CCTCACTCATTTACTCATintronicDe novo--Yuen2017 G
CPZ     2-1086-004chr4:
8642566-8642566
CAintergenicDe novo--Yuen2017 G
CPZ     iHART2479chr4:
8605776-8605776
CAexonicPaternalstopgainNM_003652
NM_001014447
NM_001014448
c.C537A
c.C570A
c.C159A
p.Y179X
p.Y190X
p.Y53X
37.0-Ruzzo2019 G
CPZ     AU057503chr4:
8762375-8762375
CAintergenicDe novo--Yuen2017 G
CPZ     3-0434-000chr4:
8649088-8649088
GTintergenicDe novo--Yuen2017 G
CPZ     1-0671-003chr4:
8618084-8618084
GAintronicDe novo--Trost2022 G
Yuen2017 G
CPZ     AU05003chr4:
8620216-8620216
CTexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.C1531T
c.C1564T
c.C1153T
p.R511W
p.R522W
p.R385W
15.268.267E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CPZ     TAS_F7056Xchr4:
8621175-8621175
GAexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.G1757A
c.G1790A
c.G1379A
p.R586K
p.R597K
p.R460K
12.3-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CPZ     12656.p1chr4:
8620162-8620162
CTexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.C1477T
c.C1510T
c.C1099T
p.R493W
p.R504W
p.R367W
14.454.126E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
CPZ     5-0025-004chr4:
8778034-8778034
CAintergenicDe novo--Yuen2017 G
CPZ     iHART2291chr4:
8621059-8621059
CGexonicMaternalstopgainNM_003652
NM_001014447
NM_001014448
c.C1641G
c.C1674G
c.C1263G
p.Y547X
p.Y558X
p.Y421X
20.12.0E-4Ruzzo2019 G
CPZ     13515.p1chr4:
8648059-8648059
GAintergenicDe novo--Turner2016 G
CPZ     1-0563-003chr4:
8604846-8604846
TCintronicDe novo--Trost2022 G
Yuen2017 G
CPZ     SSC05666chr4:
8620162-8620162
CTexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.C1477T
c.C1510T
c.C1099T
p.R493W
p.R504W
p.R367W
14.454.126E-5Fu2022 E
Lim2017 E
Trost2022 G
CPZ     AU3782302chr4:
8607844-8607844
CCTexonicPaternalframeshift insertionNM_003652
NM_001014447
NM_001014448
c.806dupT
c.839dupT
c.428dupT
p.L269fs
p.L280fs
p.L143fs
-1.0E-4Cirnigliaro2023 G
CPZ     mAGRE1224chr4:
8605917-8605917
TCsplicingMaternalsplicing18.57-Cirnigliaro2023 G
CPZ     mAGRE2479chr4:
8605776-8605776
CAexonicPaternalstopgainNM_003652
NM_001014447
NM_001014448
c.C537A
c.C570A
c.C159A
p.Y179X
p.Y190X
p.Y53X
37.0-Cirnigliaro2023 G
CPZ     mAGRE5250chr4:
8594645-8594645
GGCexonicMaternalframeshift insertionNM_001014447
NM_003652
c.86dupC
c.86dupC
p.A29fs
p.A29fs
--Cirnigliaro2023 G
CPZ     AU2792302chr4:
8621227-8621227
GAexonicDe novosynonymous SNVNM_003652
NM_001014447
NM_001014448
c.G1809A
c.G1842A
c.G1431A
p.T603T
p.T614T
p.T477T
-5.0E-4Trost2022 G
Yuen2017 G
Zhou2022 GE
CPZ     7-0095-004chr4:
8611096-8611096
TTCACTCATTTACTCATTCACCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More