or
or
Exact

Results for "NUP54"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NUP54     Uddin2014:31chr4:
77038831-77038831
GTexonicDe novosynonymous SNVNM_001278603
NM_017426
c.C1237A
c.C1381A
p.R413R
p.R461R
--Uddin2014 E
NUP54     SP0001583chr4:
77038929-77038929
TTTGsplicingDe novosplicing--Fu2022 E
NUP54     SP0145834chr4:
77069471-77069471
CTexonicDe novosynonymous SNVNM_001278603
NM_017426
c.G57A
c.G57A
p.A19A
p.A19A
--Fu2022 E
Trost2022 G
Zhou2022 GE
NUP54     AU2156303chr4:
77070116-77070116
TCupstreamDe novo--Trost2022 G
Yuen2017 G
NUP54     REACH000233chr4:
77048625-77048625
GAintronicDe novo--Trost2022 G
NUP54     AU3782302chr4:
77065446-77065446
CGsplicingPaternalsplicing18.35-Cirnigliaro2023 G
NUP54     MSSNG00371-003chr4:
77056106-77056106
TGintronicDe novo--Trost2022 G
NUP54     1-0025-006chr4:
77064689-77064689
GAintronicDe novo--Trost2022 G
Yuen2017 G
NUP54     AU2495301chr4:
77063836-77063836
TCintronicDe novo--Trost2022 G
Yuen2017 G
NUP54     AU239Achr4:
77057565-77057565
GGTAGTTTGCTGCTGCTGCTGTGTATTAAATCCTCCAAATCCCAGTexonicDe novoframeshift insertionNM_001278603
NM_017426
c.151_152insACTGGGATTTGGAGGATTTAATACACAGCAGCAGCAGCAAACTA
c.295_296insACTGGGATTTGGAGGATTTAATACACAGCAGCAGCAGCAAACTA
p.A51fs
p.T99fs
-8.278E-6Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More