or
or
Exact

Results for "USP34"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
USP34     REACH000292chr2:
61569612-61569612
TAintronicDe novo--Trost2022 G
USP34     4-0062-003chr2:
61570499-61570499
CGintronicDe novo--Trost2022 G
USP34     7-0167-003chr2:
61702658-61702658
TCintergenicDe novo--Yuen2017 G
USP34     MSSNG00201-003chr2:
61558826-61558826
TCintronicDe novo--Trost2022 G
USP34     2-0162-003chr2:
61565513-61565513
TCintronicDe novo--Trost2022 G
USP34     7-0059-003chr2:
61508442-61508443
AATTintronicDe novo--Trost2022 G
USP34     1-0261-004chr2:
61478254-61478258
TCAAGTintronicDe novo--Trost2022 G
Yuen2017 G
USP34     MT_87.3chr2:
61538141-61538141
TAintronicDe novo--Trost2022 G
USP34     1-0628-003chr2:
61504959-61504959
CTintronicDe novo--Trost2022 G
USP34     SP0157994chr2:
61505455-61505455
TGintronicDe novo--Trost2022 G
USP34     MSSNG00014-003chr2:
61679600-61679600
TCintronicDe novo--Trost2022 G
USP34     2-1764-004chr2:
61690838-61690838
GAintronicDe novo--Trost2022 G
USP34     2-1252-003chr2:
61676565-61676583
GCATCTTTGTAGAAGTTTTGintronicDe novo--Trost2022 G
USP34     2-1173-003chr2:
61625128-61625128
CTintronicDe novo--Trost2022 G
Yuen2017 G
USP34     3-0116-001chr2:
61677379-61677379
AGintronicDe novo--Trost2022 G
USP34     JASD_Fam0025chr2:
61415298-61415298
AGexonicDe novononsynonymous SNVNM_014709c.T10580Cp.I3527T13.48-Takata2018 E
USP34     5-5154-003chr2:
61641746-61641746
GAintronicDe novo--Trost2022 G
USP34     10-0010-003chr2:
61661353-61661353
GAintronicDe novo--Trost2022 G
USP34     5-5237-005chr2:
61585142-61585142
ACintronicDe novo--Trost2022 G
USP34     2-1509-003chr2:
61554481-61554481
GCintronicDe novo--Trost2022 G
Yuen2017 G
USP34     2-1774-003chr2:
61620266-61620266
TTAintronicDe novo--Trost2022 G
USP34     1-0261-003chr2:
61478254-61478258
TCAAGTintronicDe novo--Trost2022 G
Yuen2017 G
USP34     2-1736-003chr2:
61593937-61593937
CGintronicDe novo--Trost2022 G
Yuen2017 G
USP34     2-1382-003chr2:
61699195-61699195
CTintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
USP34     5-0131-003chr2:
61611251-61611253
TACTintronicDe novo--Trost2022 G
Yuen2017 G
USP34     SMHC01644s000chr2:
61454300-61454300
TAexonicDe novononsynonymous SNVNM_014709c.A7497Tp.E2499D20.2-Yuan2023 E
USP34     1-0570-003chr2:
61537998-61537998
TCintronicDe novo--Trost2022 G
Yuen2017 G
USP34     1-0555-003chr2:
61420920-61420920
CCTintronicDe novo--Trost2022 G
Yuen2017 G
USP34     AU3649304chr2:
61693216-61693216
GCintronicDe novo--Trost2022 G
Yuen2017 G
USP34     08C78540chr2:
61647859-61647859
CTintronicDe novo-1.0E-4Satterstrom2020 E
Trost2022 G
USP34     Wang2023:295chr2:
61447571-61447571
GAexonicDe novostopgainNM_014709c.C7921Tp.Q2641X37.08.288E-6Wang2023 E
USP34     08C72349chr2:
61456779-61456779
AGintronicDe novo--Satterstrom2020 E
Trost2022 G
USP34     G01-GEA-133-HIchr2:
61697840-61697840
GGCCUTR5De novo--Satterstrom2020 E
Trost2022 G
USP34     03HI2710Achr2:
61455856-61455856
TAsplicingDe novosplicing22.81.0E-4Satterstrom2020 E
Trost2022 G
Zhou2022 GE
USP34     12011.p1chr2:
61697733-61697733
CTintronicDe novo--Turner2016 G
USP34     2-1318-004chr2:
61703720-61703720
CAintergenicDe novo--Yuen2017 G
USP34     08C74889chr2:
61575846-61575846
GCintronicDe novo--Satterstrom2020 E
Trost2022 G
USP34     13874.p1chr2:
61472531-61472531
GAintronicDe novo--Turner2016 G
USP34     2-0323-003chr2:
61685297-61685297
TCintronicDe novo--Trost2022 G
Yuen2017 G
USP34     EGAN00001101030chr2:
61416178-61416178
CCAGGAexonicDe novoframeshift insertionNM_014709c.9899_9900insTCCTp.L3300fs--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
USP34     AU006804chr2:
61606725-61606725
CTintronicDe novo--Trost2022 G
Yuen2017 G
USP34     74-0265chr2:
61451538-61451538
TGintronicDe novo--Michaelson2012 G
USP34     2-0289-003chr2:
61422451-61422451
ACintronicDe novo--Trost2022 G
Yuen2017 G
USP34     1-0290-003chr2:
61703532-61703532
CCTGintergenicDe novo--Yuen2017 G
USP34     DEASD_4030_001chr2:
61492753-61492753
TCintronicDe novo--Fu2022 E
USP34     14288_p1chr2:
61647938-61647938
TCexonicDe novononsynonymous SNVNM_014709c.A74Gp.Q25R23.1-Fu2022 E
USP34     SP0126453chr2:
61417707-61417707
TAexonicDe novononsynonymous SNVNM_014709c.A9675Tp.R3225S22.8-Fu2022 E
Zhou2022 GE
USP34     SP0132874chr2:
61415089-61415089
GAUTR3De novo--Fu2022 E
Trost2022 G
Trost2022 G
USP34     AU3865301chr2:
61588017-61588017
TGintronicDe novo--Trost2022 G
Yuen2017 G
USP34     SP0065622chr2:
61486877-61486877
AGexonicDe novononsynonymous SNVNM_014709c.T5813Cp.L1938P21.9-Fu2022 E
Zhou2022 GE
USP34     2-1364-003chr2:
61504889-61504889
TCintronicDe novo--Yuen2017 G
USP34     MT_63.3chr2:
61478428-61478428
AGintronicDe novo--Trost2022 G
USP34     3-0338-000chr2:
61487315-61487315
AGintronicDe novo--Trost2022 G
USP34     AU2283301chr2:
61439536-61439540
TTTAATintronicDe novo--Trost2022 G
USP34     ASC_142560chr2:
61468651-61468656
TTAACATintronicDe novo--Satterstrom2020 E
Trost2022 G
USP34     MT_74.3chr2:
61475589-61475589
AGintronicDe novo--Trost2022 G
USP34     14-600chr2:
61417353-61417353
TCintronicDe novo--Trost2022 G
USP34     14288.p1chr2:
61647938-61647938
TCexonicDe novononsynonymous SNVNM_014709c.A74Gp.Q25R23.1-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
USP34     MSSNG00352-003chr2:
61438599-61438599
TGintronicDe novo--Trost2022 G
USP34     2-1369-003chr2:
61424564-61424564
ACintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
USP34     MSSNG00003-003chr2:
61414821-61414821
ACUTR3De novo--Trost2022 G
Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More