or
or
Exact

Results for "DNER"

Variant Events: 45

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DNER     AU4072303chr2:
230297842-230297842
GCintronicDe novo--Trost2022 G
Yuen2017 G
DNER     SP0034433chr2:
230450654-230450654
CTexonicDe novononsynonymous SNVNM_139072c.G767Ap.R256Q19.4-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
DNER     3-0244-000chr2:
230222265-230222265
AGdownstreamDe novo--Trost2022 G
DNER     AU3861303chr2:
230583812-230583812
AGintergenicDe novo--Yuen2017 G
DNER     2-1750-003chr2:
230303316-230303316
CTintronicDe novo--Trost2022 G
DNER     2-1764-004chr2:
230313933-230313933
AGintronicDe novo--Trost2022 G
DNER     MSSNG00054-004chr2:
230274434-230274434
GAintronicDe novo--Trost2022 G
DNER     5-0009-003chr2:
230282759-230282760
ACAintronicDe novo--Trost2022 G
DNER     7-0454-003chr2:
230241701-230241701
CTintronicDe novo--Trost2022 G
DNER     MSSNG00438-003chr2:
230255857-230255857
CTintronicDe novo--Trost2022 G
DNER     7-0059-003chr2:
230222784-230222785
TAATUTR3De novo--Trost2022 G
DNER     MT_186.4chr2:
230232055-230232055
GAintronicDe novo--Trost2022 G
DNER     SP0054513chr2:
230453211-230453211
ATintronicDe novo--Trost2022 G
DNER     MT_25.3chr2:
230464707-230464713
AAGCAGCAintronicDe novo--Trost2022 G
DNER     MSSNG00341-004chr2:
230424781-230424781
GTintronicDe novo--Trost2022 G
DNER     SP0072819chr2:
230453209-230453209
GTintronicDe novo--Trost2022 G
DNER     4-0062-003chr2:
230400473-230400473
CAintronicDe novo--Trost2022 G
DNER     MT_182.3chr2:
230407348-230407348
TCintronicDe novo--Trost2022 G
DNER     3-0515-001chr2:
230324804-230324804
CTintronicDe novo--Trost2022 G
DNER     4-0062-003chr2:
230400464-230400464
ACintronicDe novo--Trost2022 G
DNER     MSSNG00073-003chr2:
230523068-230523068
TCintronicDe novo--Trost2022 G
DNER     1-0125-003chr2:
230303477-230303477
ATintronicDe novo--Trost2022 G
Yuen2017 G
DNER     MT_40.3chr2:
230529583-230529583
GAintronicDe novo--Trost2022 G
DNER     MT_25.3chr2:
230498868-230498869
AGAintronicDe novo--Trost2022 G
DNER     2-0139-004chr2:
230505252-230505252
TCintronicDe novo--Trost2022 G
DNER     AU4069302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
DNER     AU024004chr2:
230480192-230480192
GAintronicDe novo--Trost2022 G
DNER     7-0035-003chr2:
230498757-230498757
CTintronicDe novo--Trost2022 G
Yuen2017 G
DNER     2-1430-003Achr2:
230496397-230496397
TCintronicDe novo--Trost2022 G
DNER     AU3052302chr2:
230238284-230238284
GAintronicDe novo--Trost2022 G
Yuen2017 G
DNER     2-1625-003chr2:
230479129-230479129
GAintronicDe novo--Trost2022 G
DNER     1-0509-003chr2:
230353322-230353322
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DNER     MT_183.3chr2:
230479959-230479959
GCintronicDe novo--Trost2022 G
DNER     2-1430-003chr2:
230496397-230496397
TCintronicDe novo--Yuen2016 G
Yuen2017 G
DNER     7-0484-003chr2:
230565120-230565120
CTintronicDe novo--Trost2022 G
DNER     2-1334-003chr2:
230400236-230400236
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DNER     AU023012chr2:
230572250-230572250
GAintronicDe novo--Trost2022 G
DNER     3-0774-000Achr2:
230550684-230550684
GAintronicDe novo--Trost2022 G
DNER     5-5101-003chr2:
230561448-230561448
CTintronicDe novo--Trost2022 G
DNER     1-0559-004chr2:
230333912-230333912
CTintronicDe novo--Trost2022 G
Yuen2017 G
DNER     2-1461-003chr2:
230311579-230311579
ATintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DNER     1-0565-004chr2:
230504795-230504795
CTintronicDe novo--Trost2022 G
Yuen2017 G
DNER     74-0355chr2:
230425407-230425407
TCintronicDe novo--Michaelson2012 G
DNER     63-343chr2:
230528244-230528244
TGintronicDe novo--Michaelson2012 G
DNER     2-1313-003chr2:
230375717-230375730
GACACACACACACAGACACACACACAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More