or
or
Exact

Results for "TNFSF11"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TNFSF11     3-0161-000chr13:
43150980-43150980
ACintronicDe novo--Trost2022 G
TNFSF11     1-0885-003chr13:
43212654-43212654
GGTintergenicDe novo--Yuen2017 G
TNFSF11     5-0117-003chr13:
43294281-43294281
CTintergenicDe novo--Yuen2017 G
TNFSF11     7-0373-003chr13:
43170898-43170898
ATintronicDe novo--Trost2022 G
TNFSF11     1-0150-004chr13:
43262653-43262653
GAintergenicDe novo--Yuen2017 G
TNFSF11     3-0305-000chr13:
43136095-43136095
GAupstreamDe novo--Trost2022 G
TNFSF11     2-1266-003chr13:
43151669-43151683
CTGTGTGTGTGTGTGCTGTGTGTGTGTGintronicDe novo--Yuen2017 G
TNFSF11     1-0372-003chr13:
43169755-43169755
AGintronicDe novo--Yuen2016 G
Yuen2017 G
TNFSF11     2-0289-003chr13:
43262653-43262653
GAintergenicDe novo--Yuen2017 G
TNFSF11     AU4159301chr13:
43285423-43285423
GAintergenicDe novo--Yuen2017 G
TNFSF11     74-0688chr13:
43174597-43174597
ATintronicDe novo--Michaelson2012 G
TNFSF11     1-0160-004chr13:
43218878-43218882
CTTAACintergenicDe novo--Yuen2017 G
TNFSF11     3-0434-000chr13:
43173508-43173508
CTintronicDe novo--Yuen2017 G
TNFSF11     2-0296-004chr13:
43195494-43195494
TTAintergenicDe novo--Yuen2017 G
TNFSF11     1-0494-003chr13:
43330713-43330713
CTintergenicDe novo--Yuen2017 G
TNFSF11     AU4211304chr13:
43220290-43220290
GTintergenicDe novo--Yuen2017 G
TNFSF11     AU3858302chr13:
43250054-43250054
CTintergenicDe novo--Yuen2017 G
TNFSF11     7-0254-004 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
TNFSF11     AU026412chr13:
43303169-43303169
CTintergenicDe novo--Yuen2017 G
TNFSF11     1-0494-003Achr13:
43330713-43330713
CTintergenicDe novo--Yuen2017 G
TNFSF11     AU4032305chr13:
43346023-43346023
CTintergenicDe novo--Yuen2017 G
TNFSF11     1-0218-003chr13:
43223042-43223042
CAintergenicDe novo--Yuen2017 G
TNFSF11     AU3713302chr13:
43251348-43251354
GTAGTTAGTAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More