
Results for "TACR1"

Variant Events: 36

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
TACR1     3-0207-000chr2:
GAintronicDe novo--Trost2022 G
TACR1     MSSNG00222-003chr2:
TCintronicDe novo--Trost2022 G
TACR1     7-0405-004chr2:
GAintronicDe novo--Trost2022 G
TACR1     1-1201-003chr2:
CGintronicDe novo--Trost2022 G
TACR1     2-1416-003Achr2:
AGUTR3De novo--Trost2022 G
TACR1     2-1579-003chr2:
GAintergenicDe novo--Yuen2017 G
TACR1     AU3761301chr2:
CTintergenicDe novo--Yuen2017 G
TACR1     AU2310301chr2:
CCTAAintronicDe novo--Trost2022 G
TACR1     AU3951302chr2:
CTintergenicDe novo--Yuen2017 G
TACR1     MSSNG00204-003chr2:
TCintronicDe novo--Trost2022 G
TACR1     1-0059-003Achr2:
GCintronicDe novo--Trost2022 G
TACR1     7-0458-003chr2:
GTintronicDe novo--Trost2022 G
TACR1     AU4359301chr2:
GAintergenicDe novo--Yuen2017 G
TACR1     7-0227-003chr2:
CCAAintronicDe novo--Trost2022 G
TACR1     7-0227-003chr2:
CCCCCCAAAAAAintronicDe novo--Trost2022 G
TACR1     AU026412chr2:
GAintronicDe novo--Trost2022 G
Yuen2017 G
TACR1     AU038203chr2:
CGintronicDe novo--Trost2022 G
Yuen2017 G
TACR1     2-1605-004chr2:
GTAAintronicDe novo--Trost2022 G
TACR1     2-1358-003chr2:
GCintergenicDe novo--Yuen2017 G
TACR1     4-0064-004chr2:
TACR1     74-0117chr2:
AGintergenicDe novo--Michaelson2012 G
TACR1     1-0402-003chr2:
GTintergenicDe novo--Yuen2017 G
TACR1     AU4159301chr2:
GCintronicDe novo--Yuen2017 G
TACR1     2-0003-003chr2:
CGintergenicDe novo--Yuen2017 G
TACR1     1-0896-003chr2:
AGintergenicDe novo--Yuen2017 G
TACR1     2-1549-003chr2:
AAGAAGCACAGAAGCAAGAAGCintergenicDe novo--Yuen2017 G
TACR1     AU4033303chr2:
CTintergenicDe novo--Yuen2017 G
TACR1     2-0135-003chr2:
ACintergenicDe novo--Yuen2017 G
TACR1     AU011704chr2:
AGintergenicDe novo--Yuen2017 G
TACR1     2-1501-003chr2:
CAintronicDe novo--Trost2022 G
Yuen2017 G
TACR1     2-1416-004chr2:
AGUTR3De novo--Yuen2017 G
TACR1     1-0570-003chr2:
GTintergenicDe novo--Yuen2017 G
TACR1     AU4032305chr2:
ACintronicDe novo--Trost2022 G
Yuen2017 G
TACR1     1-0112-003chr2:
TCintergenicDe novo--Yuen2017 G
TACR1     2-1416-003chr2:
AGUTR3De novo--Yuen2017 G
TACR1     AU060703chr2:
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView