or
or
Exact

Results for "ROCK1"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ROCK1     2-1407-003chr18:
18645455-18645455
CAintronicDe novo--Yuen2016 G
Yuen2017 G
ROCK1     1-0757-003chr18:
18682062-18682062
CTintronicDe novo--Trost2022 G
Yuen2017 G
ROCK1     AU1933301chr18:
18752136-18752136
GAintergenicDe novo--Yuen2017 G
ROCK1     7-0194-003chr18:
18770145-18770145
GAintergenicDe novo--Yuen2017 G
ROCK1     5426chr18:
18572849-18572849
GAexonicDe novosynonymous SNVNM_005406c.C1935Tp.L645L-1.653E-5Fu2022 E
Trost2022 G
ROCK1     MT_25.3chr18:
18558039-18558039
CTintronicDe novo--Trost2022 G
ROCK1     AU2320301chr18:
18558314-18558314
TCintronicDe novo--Trost2022 G
ROCK1     4-0092-003chr18:
18529816-18529816
TCUTR3De novo--Trost2022 G
ROCK1     DEASD_1042_001chr18:
18587990-18587990
TCintronicDe novo--Satterstrom2020 E
Trost2022 G
ROCK1     7-0383-003chr18:
18531882-18531882
GAintronicDe novo--Trost2022 G
ROCK1     1-0248-003chr18:
18795093-18795093
AGintergenicDe novo--Yuen2017 G
ROCK1     9-0027-003chr18:
18643074-18643074
CGintronicDe novo--Trost2022 G
ROCK1     1-0738-003chr18:
18649591-18649591
AGintronicDe novo--Trost2022 G
ROCK1     11599.p1chr18:
18572849-18572849
GAexonicDe novosynonymous SNVNM_005406c.C1935Tp.L645L-1.653E-5Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
ROCK1     SP0068712chr18:
18622658-18622658
GAexonicDe novostopgainNM_005406c.C688Tp.R230X46.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ROCK1     MSSNG00101-003chr18:
18592630-18592630
TAintronicDe novo--Trost2022 G
ROCK1     3-0736-000chr18:
18620548-18620548
GAintronicDe novo--Trost2022 G
ROCK1     1-0098-003Achr18:
18583679-18583679
ACintronicDe novo--Trost2022 G
ROCK1     REACH000349chr18:
18585613-18585613
GAintronicDe novo--Trost2022 G
ROCK1     AU2310301chr18:
18560947-18560947
AGintronicDe novo--Trost2022 G
ROCK1     3-0143-001chr18:
18566718-18566718
GCintronicDe novo--Trost2022 G
ROCK1     74-0265chr18:
18566957-18566957
TCexonicDe novononsynonymous SNVNM_005406c.A2258Gp.Q753R27.6-Michaelson2012 G
ROCK1     1-0859-003chr18:
18687021-18687021
CTintronicDe novo--Trost2022 G
ROCK1     MSSNG00216-003chr18:
18656716-18656716
CTintronicDe novo--Trost2022 G
ROCK1     REACH000696chr18:
18680783-18680783
AGintronicDe novo--Trost2022 G
ROCK1     AU2787302 Complex Event; expand row to view variants  De novosplicing--Yuen2017 G
Zhou2022 GE
ROCK1     1-0290-003chr18:
18768555-18768555
TCintergenicDe novo--Yuen2017 G
ROCK1     5-0004-003chr18:
18658500-18658530
ATGGAGTTTGAGCTCTGGGACCCATCAGTCCAintronicDe novo--Trost2022 G
Yuen2017 G
ROCK1     Lim2017:5426chr18:
18572849-18572849
GAexonicDe novosynonymous SNVNM_005406c.C1935Tp.L645L-1.653E-5Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More