or
or
Exact

Results for "RAD51B"

Variant Events: 95

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RAD51B     1-0582-003chr14:
68542550-68542550
GTintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     AU3263302chr14:
68774354-68774354
CTintronicDe novo--Yuen2017 G
RAD51B     1-0059-003Achr14:
69140841-69140845
CACATCintergenicDe novo--Trost2022 G
RAD51B     G01-GEA-99-HIchr14:
68331607-68331607
GTintronicDe novo--Fu2022 E
RAD51B     2-0090-003chr14:
68609055-68609055
TCintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     2-1562-004chr14:
68507924-68507924
CGintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     4-0049-003chr14:
69134137-69134140
GCTGAAintergenicDe novo--Trost2022 G
RAD51B     4-0049-003chr14:
69134143-69134144
TGCTintergenicDe novo--Trost2022 G
RAD51B     MSSNG00088-003chr14:
69120286-69120286
CTintergenicDe novo--Trost2022 G
RAD51B     1-0433-003chr14:
68710201-68710201
CTintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     AU2729301chr14:
69131933-69131933
CGintergenicDe novo--Trost2022 G
RAD51B     1-0255-003chr14:
69105380-69105380
TCintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
RAD51B     5-0077-004chr14:
68823563-68823563
GAintronicDe novo--Yuen2017 G
RAD51B     DEASD_1032_001chr14:
69078011-69078011
CAintergenicDe novo--Satterstrom2020 E
Trost2022 G
RAD51B     3-0661-000chr14:
69199806-69199806
GTintergenicDe novo--Yuen2017 G
RAD51B     1-0568-003chr14:
68904450-68904450
GAintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     7-0024-005chr14:
68972957-68972957
ACintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     AU3915301chr14:
69040037-69040037
TCintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     2-1370-003chr14:
68903925-68903925
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
RAD51B     AU050403chr14:
68475650-68475650
CTintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     1-0126-003chr14:
68697075-68697075
CTintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     1-0144-005chr14:
69068518-69068518
TGintergenicDe novo--Trost2022 G
Yuen2017 G
RAD51B     AU079204chr14:
68524031-68524031
CTintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     2-1521-003chr14:
68353757-68353757
GAexonicDe novononsynonymous SNVNM_002877
NM_133509
NM_133510
c.G592A
c.G592A
c.G592A
p.E198K
p.E198K
p.E198K
15.04-Trost2022 G
Yuen2017 G
Zhou2022 GE
RAD51B     AU3343301chr14:
68399823-68399823
GAintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     2-1477-003chr14:
68871859-68871859
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
RAD51B     AU2156303chr14:
68369854-68369854
CGintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     AU3053301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
RAD51B     2-1327-004chr14:
68702541-68702541
GCintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     2-0012-004chr14:
69205515-69205515
CCTCCAATCCCTCTGTGCCCCACCTTCAGTGCTintergenicDe novo--Yuen2017 G
RAD51B     7-0249-003chr14:
69213949-69213949
CTintergenicDe novo--Yuen2017 G
RAD51B     5-0117-003chr14:
68879655-68879655
AGintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     7-0167-003chr14:
68601353-68601353
AGintronicDe novo--Yuen2017 G
RAD51B     AU3846303chr14:
68794711-68794711
TCintronicDe novo--Yuen2017 G
RAD51B     1-0489-003chr14:
69013864-69013864
GAintronicDe novo--Yuen2016 G
Yuen2017 G
RAD51B     1-0995-003chr14:
68799013-68799028
TACACACACACACACATACACACACACACAintronicDe novo--Yuen2017 G
RAD51B     2-1411-003chr14:
68727079-68727079
TGintronicDe novo--Yuen2016 G
RAD51B     SP0161361chr14:
68331678-68331678
CTintronicDe novo--Trost2022 G
RAD51B     3-0484-000chr14:
68342911-68342911
GGAintronicDe novo--Trost2022 G
RAD51B     MSSNG00428-003chr14:
68291889-68291889
CTintronicDe novo--Trost2022 G
RAD51B     1-1158-003chr14:
68296855-68296855
ACintronicDe novo--Trost2022 G
RAD51B     SP0016664chr14:
68301861-68301861
CTexonicDe novononsynonymous SNVNM_002877
NM_133509
NM_133510
c.C263T
c.C263T
c.C263T
p.S88F
p.S88F
p.S88F
13.19-Fu2022 E
Zhou2022 GE
RAD51B     3-0338-000chr14:
68456974-68456974
ACintronicDe novo--Trost2022 G
RAD51B     MT_151.4chr14:
68472077-68472077
TGintronicDe novo--Trost2022 G
RAD51B     5-5146-004chr14:
68441190-68441190
TCintronicDe novo--Trost2022 G
RAD51B     AU2318301chr14:
68447758-68447758
CAintronicDe novo--Trost2022 G
RAD51B     AU070007chr14:
68699855-68699855
GAintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     MSSNG00359-004chr14:
68386846-68386846
CTintronicDe novo--Trost2022 G
RAD51B     4-0062-003chr14:
68419433-68419436
AGAAGGGGintronicDe novo--Trost2022 G
RAD51B     5-0009-003chr14:
68351359-68351359
CTintronicDe novo--Trost2022 G
RAD51B     3-0422-000chr14:
68373437-68373437
CTintronicDe novo--Trost2022 G
RAD51B     7-0233-003chr14:
68618067-68618067
CTintronicDe novo--Trost2022 G
RAD51B     74-0688chr14:
68661217-68661217
CTintronicDe novo--Michaelson2012 G
RAD51B     10-1104-003chr14:
68621994-68621994
CTintronicDe novo--Trost2022 G
RAD51B     2-1164-003chr14:
68832257-68832257
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
RAD51B     MSSNG00361-003chr14:
68591276-68591276
GAintronicDe novo--Trost2022 G
RAD51B     MSSNG00122-003chr14:
68608858-68608858
GGTintronicDe novo--Trost2022 G
RAD51B     1-0279-004chr14:
68428810-68428810
AGintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     MT_95.3chr14:
68524004-68524004
CTintronicDe novo--Trost2022 G
RAD51B     3-0428-000chr14:
68859674-68859674
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
RAD51B     1-0133-003chr14:
68546439-68546439
ATintronicDe novo--Trost2022 G
RAD51B     MSSNG00033-004chr14:
68511545-68511545
CTintronicDe novo--Trost2022 G
RAD51B     MSSNG00043-004Achr14:
68512141-68512141
AGintronicDe novo--Trost2022 G
RAD51B     2-1727-004chr14:
68723598-68723598
AGintronicDe novo--Trost2022 G
RAD51B     2-1727-003chr14:
68723598-68723598
AGintronicDe novo--Trost2022 G
RAD51B     7-0329-003chr14:
68695144-68695144
TCintronicDe novo--Trost2022 G
RAD51B     1-0609-003chr14:
68533391-68533391
CAintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     1-1155-003chr14:
68709997-68709997
CTintronicDe novo--Trost2022 G
RAD51B     AU4410302chr14:
68903881-68903881
GAintronicDe novo--Yuen2017 G
RAD51B     1-1054-003chr14:
68664324-68664324
CAintronicDe novo--Trost2022 G
RAD51B     AU3808304chr14:
68633689-68633689
CTintronicDe novo--Yuen2017 G
RAD51B     MSSNG00258-004chr14:
68674212-68674216
GAGTTGintronicDe novo--Trost2022 G
RAD51B     5-0026-003chr14:
68626307-68626307
AGintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     MSSNG00362-004chr14:
68626049-68626049
GAintronicDe novo--Trost2022 G
RAD51B     AM04ZF-03chr14:
68628884-68628884
AGintronicDe novo--Trost2022 G
RAD51B     2-0160-003chr14:
68924908-68924908
GCintronicDe novo--Trost2022 G
RAD51B     REACH000229chr14:
68951101-68951101
GTintronicDe novo--Trost2022 G
RAD51B     AU2828301chr14:
68901186-68901186
GTintronicDe novo--Trost2022 G
RAD51B     REACH000252chr14:
68917367-68917367
CTintronicDe novo--Trost2022 G
RAD51B     1-0744-003chr14:
68385709-68385709
AGintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     MSSNG00421-007chr14:
68804486-68804496
ATTTGTTTTGTAintronicDe novo--Trost2022 G
RAD51B     MSSNG00395-003chr14:
68861195-68861195
TCintronicDe novo--Trost2022 G
RAD51B     2-0295-004chr14:
68625275-68625275
CTintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     2-1327-004chr14:
68790853-68790854
TACintronicDe novo--Trost2022 G
RAD51B     2-1451-004chr14:
68745487-68745487
TCintronicDe novo--Trost2022 G
Yuen2017 G
RAD51B     2-1327-004chr14:
68790856-68790857
TATintronicDe novo--Trost2022 G
RAD51B     MSSNG00428-003chr14:
69103809-69103809
TCintergenicDe novo--Trost2022 G
RAD51B     5-0018-003chr14:
69108274-69108278
CCATTAAAAAAAAAintergenicDe novo--Trost2022 G
RAD51B     MT_69.3chr14:
69070092-69070092
CTintergenicDe novo--Trost2022 G
RAD51B     A23chr14:
68755612-68755612
TCintronicDe novo--Wu2018 G
RAD51B     MSSNG00345-003chr14:
69088893-69088893
CTintergenicDe novo--Trost2022 G
RAD51B     1-1196-003chr14:
69037500-69037500
AGintronicDe novo--Trost2022 G
RAD51B     2-1097-003chr14:
69066312-69066312
GAintergenicDe novo--Trost2022 G
RAD51B     SP0117758chr14:
69029820-69029820
AGintronicDe novo--Trost2022 G
RAD51B     SP0085036chr14:
69030110-69030110
CTintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More