or
or
Exact

Results for "PID1"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PID1     AU3905301chr2:
230137538-230137538
GCintergenicDe novo--Yuen2017 G
PID1     3-0204-000chr2:
229938819-229938820
ATAintronicDe novo--Trost2022 G
PID1     AU055603chr2:
229967251-229967251
CAintronicDe novo--Trost2022 G
PID1     1-0731-004chr2:
229898537-229898537
CGintronicDe novo--Trost2022 G
PID1     7-0287-003chr2:
229921896-229921896
GAintronicDe novo--Trost2022 G
PID1     MT_160.3chr2:
230068014-230068014
TCintronicDe novo--Trost2022 G
PID1     2-1735-003chr2:
230142696-230142696
AGintergenicDe novo--Yuen2017 G
PID1     3-0630-000chr2:
230034832-230034832
GAintronicDe novo--Trost2022 G
PID1     2-1243-003chr2:
230053642-230053642
CTintronicDe novo--Trost2022 G
PID1     1-0181-004chr2:
230029830-230029830
GAintronicDe novo--Trost2022 G
Yuen2017 G
PID1     MSSNG00439-004chr2:
229992201-229992201
GAintronicDe novo--Trost2022 G
PID1     3-0719-001chr2:
230034035-230034035
TCintronicDe novo--Trost2022 G
PID1     3-0261-000chr2:
229974004-229974004
GCintronicDe novo--Trost2022 G
PID1     11456.p1chr2:
230088191-230088191
CTintronicDe novo--Turner2016 G
PID1     MSSNG00235-003chr2:
229976269-229976269
GAintronicDe novo--Trost2022 G
PID1     2-0208-004chr2:
230053883-230053883
CTintronicDe novo--Yuen2017 G
PID1     AU1995302chr2:
229985830-229985830
CGintronicDe novo--Yuen2017 G
PID1     AU2100302chr2:
229982105-229982105
AGintronicDe novo--Trost2022 G
Yuen2017 G
PID1     1-0579-003chr2:
230042443-230042471
TTCATCATCATCATCATCATCATCATCATTTCATCATCATCATCATCATCATCATintronicDe novo--Yuen2017 G
PID1     1-0080-003chr2:
230096543-230096543
CTintronicDe novo--Yuen2017 G
PID1     2-1212-003chr2:
230138267-230138267
ATintergenicDe novo--Yuen2017 G
PID1     74-0355chr2:
230134174-230134174
AGintronicDe novo--Michaelson2012 G
PID1     2-1375-003chr2:
229922794-229922794
AGintronicDe novo--Yuen2016 G
PID1     1-0914-003chr2:
229889961-229889961
CTUTR3De novo--Trost2022 G
Yuen2017 G
PID1     3-0437-000chr2:
229888127-229888127
AGdownstreamDe novo--Trost2022 G
Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More