or
or
Exact

Results for "PEPD"

Variant Events: 41

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PEPD     1-0405-003chr19:
33998461-33998461
GAintronicDe novo--Trost2022 G
Yuen2017 G
PEPD     63-449chr19:
34109547-34109547
TCintergenicUnknown--Michaelson2012 G
PEPD     12704.p1chr19:
34003589-34003589
GAexonicDe novosynonymous SNVNM_000285
NM_001166056
NM_001166057
c.C111T
c.C111T
c.C111T
p.N37N
p.N37N
p.N37N
--Krumm2015 E
Satterstrom2020 E
Zhou2022 GE
PEPD     1-0272-004chr19:
33880414-33880414
ACintronicDe novo--Trost2022 G
Yuen2017 G
PEPD     2-1327-004chr19:
34060209-34060209
CTintergenicDe novo--Yuen2017 G
PEPD     AU054303chr19:
34056714-34056742
AAAAACAAAACAAAACAAAACAAAACAAAAAAAACAAAACAAAACAAAACAAAACAAAACAAAintergenicDe novo--Yuen2017 G
PEPD     1-0222-003chr19:
34005531-34005531
GTintronicDe novo--Trost2022 G
Yuen2017 G
PEPD     5-0117-003chr19:
33910310-33910310
CAintronicDe novo--Trost2022 G
Yuen2017 G
PEPD     1-0522-003chr19:
33944144-33944144
TGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PEPD     SSC10535chr19:
33892654-33892654
GAexonicDe novononsynonymous SNVNM_001166056
NM_001166057
NM_000285
c.C817T
c.C748T
c.C940T
p.R273C
p.R250C
p.R314C
14.665.981E-5Fu2022 E
Trost2022 G
PEPD     3-0459-000chr19:
33901923-33901923
GAintronicDe novo--Trost2022 G
PEPD     MSSNG00017-004chr19:
33905598-33905598
GAintronicDe novo--Trost2022 G
PEPD     iHART2816chr19:
33954967-33954967
GAexonicMaternalstopgainNM_001166057
NM_000285
c.C358T
c.C550T
p.R120X
p.R184X
38.04.491E-5Ruzzo2019 G
PEPD     iHART2815chr19:
33954967-33954967
GAexonicMaternalstopgainNM_001166057
NM_000285
c.C358T
c.C550T
p.R120X
p.R184X
38.04.491E-5Ruzzo2019 G
PEPD     SSC06905chr19:
34003589-34003589
GAexonicDe novosynonymous SNVNM_000285
NM_001166056
NM_001166057
c.C111T
c.C111T
c.C111T
p.N37N
p.N37N
p.N37N
--Fu2022 E
Trost2022 G
PEPD     SJD_63.3chr19:
33886897-33886897
GCintronicDe novo--Trost2022 G
PEPD     1-0862-003chr19:
33954991-33954991
CTintronicDe novo--Trost2022 G
Yuen2017 G
PEPD     2-1254-003chr19:
33934785-33934799
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
PEPD     SP0050875chr19:
33902581-33902581
AGexonicnonsynonymous SNVNM_001166056
NM_001166057
NM_000285
c.T692C
c.T623C
c.T815C
p.M231T
p.M208T
p.M272T
14.84-Zhou2022 GE
PEPD     REACH000697chr19:
33967334-33967334
CAintronicDe novo--Trost2022 G
PEPD     4-0062-003chr19:
33969637-33969638
TTAAintronicDe novo--Trost2022 G
PEPD     1-0253-004chr19:
33949178-33949180
GGCTGTGTintronicDe novo--Trost2022 G
PEPD     1-0253-004chr19:
33949183-33949186
CAGAGTGGintronicDe novo--Trost2022 G
PEPD     1-0253-004chr19:
33949166-33949169
GTAGATGGTintronicDe novo--Trost2022 G
PEPD     1-0253-004chr19:
33949173-33949174
AATGintronicDe novo--Trost2022 G
PEPD     7-0457-004chr19:
33925860-33925860
CTintronicDe novo--Trost2022 G
PEPD     14181.p1chr19:
33892654-33892654
GAexonicDe novononsynonymous SNVNM_001166056
NM_001166057
NM_000285
c.C817T
c.C748T
c.C940T
p.R273C
p.R250C
p.R314C
14.665.981E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Zhou2022 GE
PEPD     3-0153-000chr19:
33940368-33940368
GCintronicDe novo--Trost2022 G
PEPD     1-0452-003chr19:
33934785-33934799
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
PEPD     2-0198-004chr19:
33949739-33949739
GGTGTGTintronicDe novo--Yuen2017 G
PEPD     1-0514-003chr19:
33997906-33997906
CGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PEPD     MSSNG00088-003chr19:
34013584-34013584
GAupstreamDe novo--Trost2022 G
PEPD     1-0105-003chr19:
34005496-34005497
ACAintronicDe novo--Trost2022 G
PEPD     1-0738-003chr19:
34006012-34006012
CTintronicDe novo--Trost2022 G
PEPD     Wang2023:268chr19:
33904512-33904512
GAexonicDe novononsynonymous SNVNM_001166056
NM_001166057
NM_000285
c.C586T
c.C517T
c.C709T
p.R196C
p.R173C
p.R237C
23.59.15E-5Wang2023 E
PEPD     REACH000189chr19:
33976421-33976421
CAintronicDe novo--Trost2022 G
PEPD     1-0412-003chr19:
33920504-33920504
TCintronicDe novo--Trost2022 G
Yuen2017 G
PEPD     2-1296-003chr19:
33996956-33996956
CAintronicDe novo--Trost2022 G
PEPD     AU3911302chr19:
34110977-34110977
GTintergenicDe novo--Yuen2017 G
PEPD     AU2140306chr19:
33954967-33954967
GAexonicMaternalstopgainNM_001166057
NM_000285
c.C358T
c.C550T
p.R120X
p.R184X
38.04.491E-5Cirnigliaro2023 G
PEPD     AU2140305chr19:
33954967-33954967
GAexonicMaternalstopgainNM_001166057
NM_000285
c.C358T
c.C550T
p.R120X
p.R184X
38.04.491E-5Cirnigliaro2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More