or
or
Exact

Results for "ASIC2"

Variant Events: 128

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ASIC2     1-0393-003chr17:
31694763-31694763
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     5-0021-003chr17:
31625841-31625841
TGintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     1-0299-003chr17:
32338123-32338123
CCAGintronicDe novo--Yuen2017 G
ASIC2     1-0381-003chr17:
32034754-32034754
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     2-1297-004chr17:
32337950-32337950
TCintronicDe novo--Yuen2017 G
ASIC2     2-1261-003chr17:
31568782-31568782
GTintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     AU2117302chr17:
31816534-31816534
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     1-0338-003chr17:
32183455-32183455
GGTAGTAGTintronicDe novo--Yuen2017 G
ASIC2     1-0051-005chr17:
32303168-32303168
GGATCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     2-0197-004chr17:
32437439-32437439
TTCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     2-1521-003chr17:
32095922-32095922
CTintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     AU011021chr17:
32331027-32331027
AGintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     AU028305chr17:
32490315-32490315
GAintergenicDe novo--Yuen2017 G
ASIC2     5-0084-003chr17:
32338123-32338123
CCAGintronicDe novo--Yuen2017 G
ASIC2     5-0055-003chr17:
32183405-32183405
GGGTGATAintronicDe novo--Yuen2017 G
ASIC2     2-1277-003chr17:
32183455-32183455
GGTAGTAGTintronicDe novo--Yuen2017 G
ASIC2     AU034904chr17:
31963681-31963681
AGintronicDe novo--Yuen2017 G
ASIC2     AU2035301chr17:
32455744-32455744
ACintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     AU1988301chr17:
32301790-32301792
AGTAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     5-0014-003chr17:
31550416-31550416
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     2-1291-003chr17:
31372399-31372399
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ASIC2     2-1509-003chr17:
32374018-32374018
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     12793.p1chr17:
32156196-32156196
TGintronicDe novo--Turner2016 G
ASIC2     7-0051-003chr17:
31371987-31371987
GAintronicDe novo--Trost2022 G
ASIC2     MSSNG00430-003chr17:
31472643-31472643
TCintronicDe novo--Trost2022 G
ASIC2     1-0299-004chr17:
31747652-31747652
AGintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     1-1221-003chr17:
31605774-31605775
TATintronicDe novo--Trost2022 G
ASIC2     1-0763-003chr17:
32183544-32183544
GGTAAintronicDe novo--Yuen2017 G
ASIC2     7-0444-003chr17:
31650305-31650305
CTintronicDe novo--Trost2022 G
ASIC2     1-0681-003chr17:
31548950-31548950
TGintronicDe novo--Trost2022 G
ASIC2     1-1121-003chr17:
31577095-31577095
CTintronicDe novo--Trost2022 G
ASIC2     REACH000377chr17:
31484104-31484104
AGintronicDe novo--Trost2022 G
ASIC2     5-0058-003chr17:
31544432-31544432
GAintronicDe novo--Trost2022 G
ASIC2     1-1122-003chr17:
31476129-31476129
AGintronicDe novo--Trost2022 G
ASIC2     2-1686-003chr17:
31476504-31476504
GAintronicDe novo--Trost2022 G
ASIC2     2-0022-005chr17:
31368832-31368832
GTintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     3-0352-000chr17:
31784916-31784916
GAintronicDe novo--Trost2022 G
ASIC2     AU004403chr17:
31785863-31785863
ATintronicDe novo--Trost2022 G
ASIC2     AU4392301chr17:
31473820-31473820
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     MSSNG00099-004chr17:
31692976-31692976
CGintronicDe novo--Trost2022 G
ASIC2     REACH000735chr17:
31766933-31766933
GAintronicDe novo--Trost2022 G
ASIC2     5-5209-003chr17:
31686252-31686252
CGintronicDe novo--Trost2022 G
ASIC2     3-0221-000chr17:
31692191-31692192
TCAAintronicDe novo--Trost2022 G
ASIC2     AU4410302chr17:
32060376-32060376
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     MT_179.4chr17:
31658337-31658337
CTintronicDe novo--Trost2022 G
ASIC2     2-1350-004chr17:
32179858-32179858
CAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     3-0174-000chr17:
31675069-31675069
GAintronicDe novo--Trost2022 G
ASIC2     1-1100-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
ASIC2     AU2828301chr17:
31846892-31846892
CTintronicDe novo--Trost2022 G
ASIC2     1-0354-006chr17:
31357901-31357901
CTintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     MSSNG00365-003chr17:
31837993-31837993
GAintronicDe novo--Trost2022 G
ASIC2     5-0041-003chr17:
32109195-32109195
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     7-0178-003chr17:
31840574-31840574
GCintronicDe novo--Trost2022 G
ASIC2     3-0159-000chr17:
31824055-31824055
TCintronicDe novo--Trost2022 G
ASIC2     MSSNG00257-005chr17:
31831348-31831348
CTintronicDe novo--Trost2022 G
ASIC2     1-1154-003chr17:
31818959-31818959
ATintronicDe novo--Trost2022 G
ASIC2     3-0713-000chr17:
31820287-31820287
TAintronicDe novo--Trost2022 G
ASIC2     MSSNG00108-003chr17:
31897572-31897572
GAintronicDe novo--Trost2022 G
ASIC2     2-1349-003chr17:
31931030-31931030
GTintronicDe novo--Trost2022 G
ASIC2     1030chr17:
31884846-31884846
CAintronicDe novo--Trost2022 G
ASIC2     1-1036-003chr17:
31889364-31889364
GTintronicDe novo--Trost2022 G
ASIC2     MT_167.3chr17:
31867509-31867509
GAintronicDe novo--Trost2022 G
ASIC2     MSSNG00033-005chr17:
31875037-31875037
TGintronicDe novo--Trost2022 G
ASIC2     AU0146302chr17:
31906557-31906557
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     AU055603chr17:
31850157-31850157
TAintronicDe novo--Trost2022 G
ASIC2     3-0099-000chr17:
31978461-31978461
TCintronicDe novo--Trost2022 G
ASIC2     2-0278-003chr17:
32032048-32032048
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     1-1100-003chr17:
31989443-31989443
CGintronicDe novo--Trost2022 G
ASIC2     7-0416-003chr17:
31975715-31975715
ATintronicDe novo--Trost2022 G
ASIC2     1-1154-003chr17:
31978323-31978323
GAintronicDe novo--Trost2022 G
ASIC2     1-0541-004chr17:
32338123-32338123
CCAGintronicDe novo--Yuen2017 G
ASIC2     5-1012-004chr17:
31954152-31954152
TCintronicDe novo--Trost2022 G
ASIC2     2-0300-004chr17:
32183388-32183388
GGCAGTAGCAGTGCTAGTGGTGGTGGTGGTAGTAGTAGTAATAGTATintronicDe novo--Yuen2017 G
Yuen2017 G
ASIC2     2-1295-003chr17:
32237835-32237835
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ASIC2     REACH000540chr17:
31960630-31960630
AGintronicDe novo--Trost2022 G
ASIC2     2-1349-003chr17:
31931087-31931087
GCintronicDe novo--Trost2022 G
ASIC2     1-0319-004chr17:
31939050-31939050
CTintronicDe novo--Trost2022 G
ASIC2     1-1123-003chr17:
32110945-32110945
GAintronicDe novo--Trost2022 G
ASIC2     1-0627-005chr17:
31848377-31848377
CGintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     4-0077-003chr17:
32138538-32138539
ATGAintronicDe novo--Trost2022 G
ASIC2     2-1391-004chr17:
32063844-32063849
ACCATGTTTTTTTTTintronicDe novo--Trost2022 G
ASIC2     AU2328301chr17:
32068324-32068324
CTintronicDe novo--Trost2022 G
ASIC2     3-0711-000Achr17:
32041304-32041304
AGintronicDe novo--Trost2022 G
ASIC2     2-0219-004chr17:
32063844-32063849
ACCATGTTTTTTTintronicDe novo--Trost2022 G
ASIC2     60-2027chr17:
32292578-32292578
AGintronicDe novo--Michaelson2012 G
ASIC2     MSSNG00374-003chr17:
31995096-31995096
GCintronicDe novo--Trost2022 G
ASIC2     1-0120-003chr17:
32094675-32094675
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     5-0087-003chr17:
31689639-31689640
CACintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     5-5027-003chr17:
32019580-32019580
TCintronicDe novo--Trost2022 G
ASIC2     7-0392-004chr17:
32239694-32239694
GTintronicDe novo--Trost2022 G
ASIC2     5-1003-003chr17:
32260845-32260846
TCATintronicDe novo--Trost2022 G
ASIC2     AU2310301chr17:
32192880-32192880
CAintronicDe novo--Trost2022 G
ASIC2     3-0163-000chr17:
32216316-32216316
GAintronicDe novo--Trost2022 G
ASIC2     1-0236-004chr17:
32183569-32183569
CTintronicDe novo--Trost2022 G
ASIC2     MT_151.4chr17:
32190652-32190652
GTintronicDe novo--Trost2022 G
ASIC2     2-1426-003chr17:
31410850-31410850
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     4-0062-003chr17:
32138538-32138539
ATGAintronicDe novo--Trost2022 G
ASIC2     4-0073-003chr17:
32138538-32138539
ATGAintronicDe novo--Trost2022 G
ASIC2     4-0049-003chr17:
32404048-32404052
ATAACAintronicDe novo--Trost2022 G
ASIC2     AU023012chr17:
32465736-32465736
CAintronicDe novo--Trost2022 G
ASIC2     MSSNG00003-004chr17:
32342636-32342636
AGintronicDe novo--Trost2022 G
ASIC2     3-0544-000chr17:
32363256-32363256
CGintronicDe novo--Trost2022 G
ASIC2     AU2571301chr17:
32341882-32341882
GAintronicDe novo--Trost2022 G
ASIC2     MT_75.3chr17:
32342132-32342132
TCintronicDe novo--Trost2022 G
ASIC2     1-0568-003chr17:
32260845-32260846
TCATintronicDe novo--Trost2022 G
ASIC2     AU2215302chr17:
31380766-31380766
CTintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     4-0073-003chr17:
32318424-32318425
CTAAintronicDe novo--Trost2022 G
ASIC2     AU2485305chr17:
32216011-32216011
GCintronicDe novo--Yuen2017 G
ASIC2     AU2035302chr17:
32455744-32455744
ACintronicDe novo--Yuen2017 G
ASIC2     AU3779302chr17:
31817875-31817875
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     1-0153-004chr17:
32011619-32011619
CAintronicDe novo--Yuen2017 G
ASIC2     3-0446-000chr17:
32488322-32488322
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ASIC2     AU1542303chr17:
32341629-32341629
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     3-0209-000chr17:
31923379-31923379
TGintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     1-0007-003chr17:
32275955-32275955
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     AU3846303chr17:
31405784-31405784
TCintronicDe novo--Yuen2017 G
ASIC2     2-1619-003chr17:
32338123-32338123
CCAGintronicDe novo--Yuen2017 G
ASIC2     1-0551-003chr17:
32337969-32337969
TGintronicDe novo--Yuen2017 G
ASIC2     2-0145-004chr17:
31663843-31663843
GTintronicDe novo--Yuen2017 G
ASIC2     AU2109302chr17:
31688949-31688949
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     7-0149-003chr17:
31809239-31809239
CTintronicDe novo--Yuen2017 G
ASIC2     7-0149-003chr17:
32334611-32334611
CAintronicDe novo--Yuen2017 G
ASIC2     AU2863302chr17:
32394801-32394801
TCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     1-0048-003chr17:
32236213-32236213
GCintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     2-1416-004chr17:
32338123-32338123
CCAGintronicDe novo--Yuen2017 G
ASIC2     AU4463303chr17:
32146322-32146322
CAintronicDe novo--Yuen2017 G
ASIC2     2-0305-004chr17:
32002861-32002861
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASIC2     2-1427-003chr17:
32141557-32141557
TGintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More