or
or
Exact

Results for "TMEM132D"

Variant Events: 109

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TMEM132D     1-0079-008chr12:
130212290-130212290
GAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0404-003chr12:
130306044-130306044
GAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     2-0063-005chr12:
130485319-130485319
CTintergenicDe novo--Yuen2017 G
TMEM132D     SP0072291chr12:
129822358-129822358
CAexonicDe novononsynonymous SNVNM_133448c.G1120Tp.D374Y12.73-Fu2022 E
Trost2022 G
Zhou2022 GE
TMEM132D     2-1605-004chr12:
130459649-130459649
AAAAACintergenicDe novo--Yuen2017 G
TMEM132D     SP0064065chr12:
129563018-129563018
TCintronicDe novo--Fu2022 E
TMEM132D     SP0000267chr12:
129569233-129569233
AGexonicDe novosynonymous SNVNM_133448c.T1458Cp.C486C--Fu2022 E
Trost2022 G
Zhou2022 GE
TMEM132D     AU072504chr12:
129714893-129714893
CAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0395-004chr12:
130056138-130056138
ATintronicDe novo--Yuen2017 G
TMEM132D     5-0017-004chr12:
129909831-129909831
CTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     AU4028302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
TMEM132D     AU072905chr12:
130435954-130435954
CAintergenicDe novo--Yuen2017 G
TMEM132D     1-0045-003chr12:
129905565-129905565
GTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0019-004chr12:
130378968-130378968
AGintronicDe novo--Yuen2017 G
TMEM132D     2-1322-004chr12:
130400777-130400777
GAintergenicDe novo--Yuen2017 G
TMEM132D     14153.p1chr12:
130439149-130439149
AGintergenicDe novo--Turner2016 G
TMEM132D     2-0323-004chr12:
129574091-129574091
CCGintronicDe novo--Yuen2017 G
TMEM132D     4-0028-003chr12:
129699119-129699119
CAintronicDe novo--Trost2022 G
TMEM132D     5-1003-003chr12:
129706580-129706581
AACCintronicDe novo--Trost2022 G
TMEM132D     3-0489-000chr12:
129630583-129630583
AGintronicDe novo--Trost2022 G
TMEM132D     1-0701-003chr12:
129632116-129632117
GTGintronicDe novo--Trost2022 G
TMEM132D     1-1191-003chr12:
129600927-129600927
ATintronicDe novo--Trost2022 G
TMEM132D     2-1592-003chr12:
129613571-129613571
GAintronicDe novo--Trost2022 G
TMEM132D     5-5025-004chr12:
129826191-129826191
GTintronicDe novo--Trost2022 G
TMEM132D     5-0009-003chr12:
129845248-129845248
GAintronicDe novo--Trost2022 G
TMEM132D     4-0102-003chr12:
129783342-129783342
CTintronicDe novo--Trost2022 G
TMEM132D     3-0621-000Achr12:
129789544-129789544
ACintronicDe novo--Trost2022 G
TMEM132D     7-0394-003chr12:
129764753-129764753
CAintronicDe novo--Trost2022 G
TMEM132D     74-0355chr12:
129581774-129581774
CTintronicDe novo--Michaelson2012 G
TMEM132D     5-5020-003chr12:
129775092-129775092
AGintronicDe novo--Trost2022 G
TMEM132D     AU2508301chr12:
129706828-129706828
CTintronicDe novo--Trost2022 G
TMEM132D     1-0750-003chr12:
129741913-129741913
GAintronicDe novo--Trost2022 G
TMEM132D     2-0003-004chr12:
130435547-130435547
GAintergenicDe novo--Yuen2017 G
TMEM132D     9-0010-003chr12:
129951386-129951386
ACintronicDe novo--Trost2022 G
TMEM132D     2-1740-003chr12:
129961848-129961849
ACAintronicDe novo--Trost2022 G
TMEM132D     63-449chr12:
129763346-129763346
CTintronicDe novo--Michaelson2012 G
TMEM132D     7-0274-003chr12:
129904345-129904345
GCintronicDe novo--Trost2022 G
TMEM132D     7-0266-003chr12:
129950817-129950817
ATintronicDe novo--Trost2022 G
TMEM132D     2-1540-003chr12:
129887913-129887913
GAintronicDe novo--Trost2022 G
TMEM132D     MSSNG00354-004chr12:
129898546-129898546
GAintronicDe novo--Trost2022 G
TMEM132D     MSSNG00378-003chr12:
129845820-129845820
TCintronicDe novo--Trost2022 G
TMEM132D     2-1581-003chr12:
129568016-129568016
GAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-1159-003chr12:
129872264-129872264
TGintronicDe novo--Trost2022 G
TMEM132D     7-0189-003chr12:
130063344-130063344
AGintronicDe novo--Trost2022 G
TMEM132D     7-0342-004chr12:
130091569-130091569
TCintronicDe novo--Trost2022 G
TMEM132D     AU2718301chr12:
130047498-130047498
GAintronicDe novo--Trost2022 G
TMEM132D     3-0787-000chr12:
130054718-130054718
CTintronicDe novo--Trost2022 G
TMEM132D     5-0138-003chr12:
130304917-130304917
CTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0319-004chr12:
129993355-129993355
CTintronicDe novo--Trost2022 G
TMEM132D     1-0976-003chr12:
130401786-130401786
CTintergenicDe novo--Yuen2017 G
TMEM132D     AU3849302chr12:
130182765-130182765
GTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     MSSNG00010-003chr12:
130002763-130002764
TCTintronicDe novo--Trost2022 G
TMEM132D     2-1198-003chr12:
129965486-129965486
CAintronicDe novo--Trost2022 G
TMEM132D     AU039305chr12:
130429901-130429901
GAintergenicDe novo--Yuen2017 G
TMEM132D     MSSNG00015-004chr12:
129989429-129989429
GCintronicDe novo--Trost2022 G
TMEM132D     1-0896-003chr12:
129637937-129637937
ATintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     2-0286-004chr12:
130176679-130176680
CAACintronicDe novo--Trost2022 G
TMEM132D     2-1724-003chr12:
130179276-130179276
GAintronicDe novo--Trost2022 G
TMEM132D     MSSNG00017-003chr12:
130121975-130121975
GAintronicDe novo--Trost2022 G
TMEM132D     MSSNG00343-004chr12:
130143175-130143175
TGintronicDe novo--Trost2022 G
TMEM132D     MSSNG00035-003chr12:
130110626-130110626
TAintronicDe novo--Trost2022 G
TMEM132D     P6Q4Z_01chr12:
130119037-130119037
GAintronicDe novo--Trost2022 G
TMEM132D     1-0214-003chr12:
130235440-130235440
TGintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     2-1349-003chr12:
130097327-130097327
TCintronicDe novo--Trost2022 G
TMEM132D     REACH000446chr12:
130099640-130099640
GAintronicDe novo--Trost2022 G
TMEM132D     REACH000678chr12:
130265912-130265912
CTintronicDe novo--Trost2022 G
TMEM132D     2-1381-003chr12:
130214562-130214562
CGintronicDe novo--Yuen2017 G
TMEM132D     MT_161.3chr12:
130289958-130289958
AGintronicDe novo--Trost2022 G
TMEM132D     AM03ZF-03chr12:
130253791-130253791
GAintronicDe novo--Trost2022 G
TMEM132D     MSSNG00341-003chr12:
130255516-130255516
CTintronicDe novo--Trost2022 G
TMEM132D     7-0416-003chr12:
130227990-130227990
CTintronicDe novo--Trost2022 G
TMEM132D     MSSNG00424-003chr12:
130246434-130246434
TCintronicDe novo--Trost2022 G
TMEM132D     AU2283301chr12:
130209166-130209166
CTintronicDe novo--Trost2022 G
TMEM132D     MSSNG00358-004chr12:
130218138-130218138
GAintronicDe novo--Trost2022 G
TMEM132D     MSSNG00089-003chr12:
130374892-130374892
GAintronicDe novo--Trost2022 G
TMEM132D     7-0059-003chr12:
130377392-130377393
GCATintronicDe novo--Trost2022 G
TMEM132D     AU2156303chr12:
130304411-130304411
GGCTGCTACintronicDe novo--Trost2022 G
TMEM132D     1-0337-003chr12:
130338991-130338991
CAintronicDe novo--Trost2022 G
TMEM132D     AU009805chr12:
129816853-129816853
CTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     2-1129-003chr12:
129873332-129873338
GATAATAGATAintronicDe novo--Yuen2017 G
TMEM132D     2-0002-005chr12:
130267805-130267805
TCintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0206-004chr12:
130326773-130326773
GAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0701-003chr12:
129743481-129743481
ACintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     AU0146302chr12:
130110789-130110789
CTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     AU2022302chr12:
130145138-130145138
AGintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0464-003chr12:
129677454-129677454
GAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     3-0396-000chr12:
129839690-129839690
GAintronicDe novo--Yuen2016 G
TMEM132D     1-0022-004chr12:
129873418-129873418
ATintronicDe novo--Yuen2017 G
TMEM132D     1-0022-004chr12:
129873415-129873415
GAintronicDe novo--Yuen2017 G
TMEM132D     AU3371303chr12:
129961360-129961360
GAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     AU050403chr12:
129943083-129943083
AGintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0625-003chr12:
130458583-130458583
GAintergenicDe novo--Yuen2017 G
TMEM132D     5-0099-003chr12:
130264374-130264374
GCintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0373-003chr12:
129874263-129874263
CGintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     2-1348-003chr12:
130020856-130020856
GTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0395-003chr12:
130056138-130056138
ATintronicDe novo--Yuen2017 G
TMEM132D     AU4412302chr12:
130464613-130464613
GAintergenicDe novo--Yuen2017 G
TMEM132D     7-0058-003chr12:
130074047-130074047
AAGTATintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     AU3637301chr12:
130502998-130502998
CAintergenicDe novo--Yuen2017 G
TMEM132D     AU2975302chr12:
129738636-129738636
CTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     2-0127-004chr12:
130326033-130326033
TCintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     AU3637301chr12:
130283849-130283849
ATintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     SP0183765chr12:
129558473-129558473
CTexonicnonsynonymous SNVNM_133448c.G3247Ap.G1083R20.3-Zhou2022 GE
TMEM132D     1-0558-003chr12:
130134481-130134496
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
TMEM132D     AU048206chr12:
129772372-129772372
GTintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     2-1322-003chr12:
130400777-130400777
GAintergenicDe novo--Yuen2017 G
TMEM132D     1-0025-004chr12:
129774862-129774862
TCintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0354-003chr12:
129998406-129998406
GAintronicDe novo--Trost2022 G
Yuen2017 G
TMEM132D     1-0559-005chr12:
130277334-130277334
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More