or
or
Exact

Results for "PTPRN2"

Variant Events: 69

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PTPRN2     AU3984301chr7:
157925880-157925880
GCintronicDe novo--Yuen2017 G
PTPRN2     AU4056301chr7:
157496674-157496674
CTintronicDe novo--Yuen2017 G
PTPRN2     1-1000-003chr7:
157570021-157570021
AGintronicDe novo--Yuen2017 G
PTPRN2     AU3885305chr7:
158004719-158004719
TCintronicDe novo--Yuen2017 G
PTPRN2     AU079204chr7:
158181253-158181253
CTintronicDe novo--Yuen2017 G
PTPRN2     5-0003-004chr7:
157978939-157978939
TCintronicDe novo--Yuen2017 G
PTPRN2     14271.p1chr7:
157709768-157709768
TCintronicDe novo--Wilfert2021 G
PTPRN2     12011.p1chr7:
157483577-157483577
GCintronicDe novo--Turner2016 G
PTPRN2     AU028305chr7:
157467067-157467067
CTintronicDe novo--Yuen2017 G
PTPRN2     2-1442-003chr7:
157453697-157453697
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRN2     7-0100-004chr7:
157802874-157802874
CTintronicDe novo--Yuen2017 G
PTPRN2     1-0756-004chr7:
157383039-157383048
AGACCCCTCTAintronicDe novo--Yuen2017 G
PTPRN2     AU3763305chr7:
157812669-157812669
CTintronicDe novo--Yuen2017 G
PTPRN2     Chen2017:88chr7:
157959743-157959743
CTexonicDe novononsynonymous SNVNM_001308267
NM_130842
NM_001308268
NM_002847
NM_130843
c.G676A
c.G739A
c.G859A
c.G790A
c.G790A
p.E226K
p.E247K
p.E287K
p.E264K
p.E264K
11.93-Chen2017 E
PTPRN2     AU3858303chr7:
157767003-157767003
ACintronicDe novo--Yuen2017 G
PTPRN2     7-0078-003chr7:
158255625-158255625
CTintronicDe novo--Yuen2017 G
PTPRN2     AU4199303chr7:
157987458-157987458
GAintronicDe novo--Yuen2017 G
PTPRN2     AU4286302chr7:
158286036-158286044
TACACACACTACACintronicDe novo--Yuen2017 G
PTPRN2     1-0181-004chr7:
157820281-157820281
CTintronicDe novo--Yuen2017 G
PTPRN2     1-0271-004chr7:
157406986-157406987
CGCintronicDe novo--Yuen2017 G
PTPRN2     A28chr7:
157866319-157866319
GAintronicDe novo--Wu2018 G
PTPRN2     2-0132-004chr7:
158239052-158239052
GAintronicDe novo--Yuen2017 G
PTPRN2     2-0296-003chr7:
157961752-157961752
GCintronicDe novo--Yuen2017 G
PTPRN2     iHART2624chr7:
157926370-157926374
CTCTGCexonicMaternalframeshift deletionNM_001308267
NM_130842
NM_001308268
NM_002847
NM_130843
c.1437_1440del
c.1500_1503del
c.1620_1623del
c.1551_1554del
c.1551_1554del
p.D479fs
p.D500fs
p.D540fs
p.D517fs
p.D517fs
-9.044E-6Ruzzo2019 G
PTPRN2     AU3912301chr7:
158073853-158073853
CTintronicDe novo--Yuen2017 G
PTPRN2     08C71698chr7:
157929368-157929368
GAexonicDe novosynonymous SNVNM_001308267
NM_130842
NM_001308268
NM_002847
NM_130843
c.C1038T
c.C1101T
c.C1221T
c.C1152T
c.C1152T
p.D346D
p.D367D
p.D407D
p.D384D
p.D384D
-6.0E-4Satterstrom2020 E
PTPRN2     1-0222-003chr7:
157794970-157794970
CTintronicDe novo--Yuen2017 G
PTPRN2     2-1376-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
PTPRN2     12441.p1chr7:
157414064-157414064
GGGCCAGTTTCCACCGCCCGTAACCCAGGCTTCCTGCCCCCAGGGCTGGTACGTACAGGTCAGCACAexonicDe novoframeshift insertionNM_001308267
NM_130842
NM_130843
NM_001308268
NM_002847
c.2219_2220insTGTGCTGACCTGTACGTACCAGCCCTGGGGGCAGGAAGCCTGGGTTACGGGCGGTGGAAACTGGC
c.2282_2283insTGTGCTGACCTGTACGTACCAGCCCTGGGGGCAGGAAGCCTGGGTTACGGGCGGTGGAAACTGGC
c.2246_2247insTGTGCTGACCTGTACGTACCAGCCCTGGGGGCAGGAAGCCTGGGTTACGGGCGGTGGAAACTGGC
c.2402_2403insTGTGCTGACCTGTACGTACCAGCCCTGGGGGCAGGAAGCCTGGGTTACGGGCGGTGGAAACTGGC
c.2333_2334insTGTGCTGACCTGTACGTACCAGCCCTGGGGGCAGGAAGCCTGGGTTACGGGCGGTGGAAACTGGC
p.A740fs
p.A761fs
p.A749fs
p.A801fs
p.A778fs
-8.664E-6Satterstrom2020 E
PTPRN2     200675254@1082034986chr7:
157959743-157959743
CTexonicDe novononsynonymous SNVNM_001308267
NM_130842
NM_001308268
NM_002847
NM_130843
c.G676A
c.G739A
c.G859A
c.G790A
c.G790A
p.E226K
p.E247K
p.E287K
p.E264K
p.E264K
11.93-Satterstrom2020 E
PTPRN2     AU0452303chr7:
158055866-158055866
ATintronicDe novo--Yuen2017 G
PTPRN2     AU050604chr7:
157949191-157949191
GAintronicDe novo--Yuen2017 G
PTPRN2     2-0068-003chr7:
157854255-157854255
GAintronicDe novo--Yuen2017 G
PTPRN2     AU3302302chr7:
158334533-158334533
GAintronicDe novo--Yuen2017 G
PTPRN2     1-0433-004chr7:
157741901-157741901
CAintronicDe novo--Yuen2017 G
PTPRN2     2-1382-003chr7:
157409801-157409801
GCintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRN2     AU1640302chr7:
158316353-158316359
AGTCGTCAGTCintronicDe novo--Yuen2017 G
PTPRN2     2-1731-003chr7:
158286036-158286044
TACACACACTACACintronicDe novo--Yuen2017 G
PTPRN2     5-0105-003chr7:
157774602-157774602
GAintronicDe novo--Yuen2017 G
PTPRN2     7-0001-003chr7:
157352263-157352263
GAintronicDe novo--Yuen2017 G
PTPRN2     11C120958chr7:
157367159-157367159
CTintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
PTPRN2     AU4183301chr7:
157364196-157364201
AAGAGAAAGAintronicDe novo--Yuen2017 G
PTPRN2     12510.p1chr7:
158109533-158109533
CTexonicDe novosynonymous SNVNM_130842
NM_001308268
NM_002847
NM_130843
c.G204A
c.G324A
c.G255A
c.G255A
p.A68A
p.A108A
p.A85A
p.A85A
-7.118E-5Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
PTPRN2     1-0372-003chr7:
157726545-157726545
AGintronicDe novo--Yuen2017 G
PTPRN2     1-0372-003chr7:
157726541-157726541
ATintronicDe novo--Yuen2017 G
PTPRN2     2-1137-003chr7:
158132521-158132521
AGintronicDe novo--Yuen2017 G
PTPRN2     AU4234303chr7:
157369557-157369557
GAintronicDe novo--Yuen2017 G
PTPRN2     2-0145-003chr7:
157859271-157859271
GAintronicDe novo--Yuen2017 G
PTPRN2     2-1359-004chr7:
157548078-157548078
GAintronicDe novo--Yuen2017 G
PTPRN2     2-0122-003chr7:
158168962-158168962
CTintronicDe novo--Yuen2017 G
PTPRN2     2-0028-003chr7:
158060667-158060667
CTintronicDe novo--Yuen2016 G
PTPRN2     AU3586303chr7:
157988573-157988575
GGAGintronicDe novo--Yuen2017 G
PTPRN2     1-0489-003chr7:
157415390-157415390
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRN2     AU024004chr7:
157330760-157330760
GTdownstreamDe novo--Yuen2017 G
PTPRN2     AU3889305chr7:
158286036-158286044
TACACACACTACACintronicDe novo--Yuen2017 G
PTPRN2     1-0756-005chr7:
157383039-157383048
AGACCCCTCTAintronicDe novo--Yuen2017 G
PTPRN2     2-1375-003chr7:
157748283-157748283
TGintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRN2     AU3858302chr7:
157840720-157840720
GAintronicDe novo--Yuen2017 G
PTPRN2     AU3846302chr7:
158310998-158310998
AGintronicDe novo--Yuen2017 G
PTPRN2     2-1368-003chr7:
158314629-158314629
CTintronicDe novo--Yuen2017 G
PTPRN2     AU3263302chr7:
157925706-157925706
AGintronicDe novo--Yuen2017 G
PTPRN2     1-0345-003chr7:
157392328-157392328
CTintronicDe novo--Yuen2017 G
PTPRN2     2-1235-004chr7:
157569694-157569694
TCintronicDe novo--Yuen2017 G
PTPRN2     1-0627-005chr7:
157685799-157685805
GAACAAAGAAintronicDe novo--Yuen2017 G
PTPRN2     AU4007301chr7:
157638303-157638303
TCintronicDe novo--Yuen2017 G
PTPRN2     2-1258-003chr7:
157586893-157586893
CCCTCCGACCCGGGCTCACACCTCCCCTCGTTCTCTGintronicDe novo--Yuen2017 G
PTPRN2     1-0353-003chr7:
157564948-157564952
CACAGCintronicDe novo--Yuen2017 G
PTPRN2     AU3368302chr7:
157404691-157404691
CAintronicDe novo--Yuen2017 G
PTPRN2     2-1459-003chr7:
158348346-158348346
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More