or
or
Exact

Results for "SV2C"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SV2C     2-1215-003chr5:
75551652-75551652
TAintronicDe novo--Yuen2017 G
SV2C     3-0431-000chr5:
75679773-75679788
CATATATATATATATACATATATATATATAintergenicDe novo--Yuen2017 G
SV2C     11078.p1chr5:
75469979-75469979
GTintronicDe novo--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
SV2C     iHART1461chr5:
75587603-75587604
CTCexonicPaternalframeshift deletionNM_001297716
NM_014979
c.1260delT
c.1260delT
p.T420fs
p.T420fs
-1.133E-5Ruzzo2019 G
SV2C     7-0222-003chr5:
75555132-75555132
GAintronicDe novo--Yuen2017 G
SV2C     AU021204chr5:
75690175-75690175
AGintergenicDe novo--Yuen2017 G
SV2C     AU072905chr5:
75528223-75528223
CGintronicDe novo--Yuen2017 G
SV2C     1-0282-003chr5:
75390860-75390860
TCintronicDe novo--Yuen2017 G
SV2C     AU021204chr5:
75690170-75690170
CTintergenicDe novo--Yuen2017 G
SV2C     AU025704chr5:
75550965-75550965
GCintronicDe novo--Yuen2017 G
SV2C     1-0304-003chr5:
75399196-75399196
CGintronicDe novo--Yuen2016 G
Yuen2017 G
SV2C     1-0756-005chr5:
75546836-75546836
CAintronicDe novo--Yuen2017 G
SV2C     1-0567-003chr5:
75573028-75573039
AAGCTAAACATGAintronicDe novo--Yuen2017 G
SV2C     3-0447-000chr5:
75686260-75686260
TCintergenicDe novo--Yuen2017 G
SV2C     A20chr5:
75586841-75586841
CGintronicDe novo--Wu2018 G
SV2C     1-0595-004chr5:
75658617-75658617
TAintergenicDe novo--Yuen2017 G
SV2C     AU4103301chr5:
75537942-75537942
AGintronicDe novo--Yuen2017 G
SV2C     1-0448-003chr5:
75619222-75619222
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More