or
or
Exact

Results for "FREM3"

Variant Events: 26

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FREM3     5-0083-003chr4:
144739799-144739799
CTintergenicDe novo--Yuen2017 G
FREM3     1-0757-003chr4:
144532710-144532710
TGintronicDe novo--Yuen2017 G
FREM3     3-0456-000chr4:
144772001-144772001
TCintergenicDe novo--Yuen2017 G
FREM3     3-0456-000chr4:
144772009-144772009
AGintergenicDe novo--Yuen2017 G
FREM3     12449.p1chr4:
144619732-144619732
AGexonicDe novosynonymous SNVNM_001168235c.T2097Cp.D699D--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Turner2016 G
FREM3     3-0456-000chr4:
144772054-144772054
AGintergenicDe novo--Yuen2017 G
FREM3     AU4150301chr4:
144643926-144643926
AGintergenicDe novo--Yuen2017 G
FREM3     1-0441-003chr4:
144790473-144790473
CAintergenicDe novo--Yuen2017 G
FREM3     2-1166-003chr4:
144614971-144614971
TCintronicDe novo--Yuen2016 G
Yuen2017 G
FREM3     AU000704chr4:
144513862-144513862
AGintronicDe novo--Yuen2017 G
FREM3     1-0508-003chr4:
144709525-144709525
AGintergenicDe novo--Yuen2017 G
FREM3     iHART2559chr4:
144618772-144618772
ACexonicMaternalstopgainNM_001168235c.T3057Gp.Y1019X40.03.0E-4Ruzzo2019 G
FREM3     7-0078-003chr4:
144670298-144670321
GAAAGAAAAGAAAAGAAAAGAAAAGAAAGAAAAGAAAAGAAAAintergenicDe novo--Yuen2017 G
FREM3     2-1502-003chr4:
144558701-144558701
GAintronicDe novo--Yuen2017 G
FREM3     AU4233301chr4:
144777729-144777729
GCintergenicDe novo--Yuen2017 G
FREM3     SSC05051chr4:
144619732-144619732
AGexonicDe novosynonymous SNVNM_001168235c.T2097Cp.D699D--Lim2017 E
FREM3     2-0182-003chr4:
144525203-144525203
CAintronicDe novo--Yuen2017 G
FREM3     2-0296-004chr4:
144660141-144660141
CTintergenicDe novo--Yuen2017 G
FREM3     2-1720-003chr4:
144610586-144610586
CTintronicDe novo--Yuen2017 G
FREM3     7-0024-005chr4:
144573477-144573477
GAintronicDe novo--Yuen2017 G
FREM3     1-0206-005chr4:
144504433-144504433
TCintronicDe novo--Yuen2017 G
FREM3     1-0651-003chr4:
144679393-144679393
AGintergenicDe novo--Yuen2017 G
FREM3     AU4067303chr4:
144756978-144756993
GTTTGTTTCTTTGTTTGTTTGTTTintergenicDe novo--Yuen2017 G
FREM3     11074.p1chr4:
144620325-144620325
GAexonicDe novostopgainNM_001168235c.C1504Tp.R502X25.3-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
FREM3     A1chr4:
144629728-144629728
GTintergenicDe novo--Wu2018 G
FREM3     13277.p1chr4:
144700392-144700392
GAintergenicDe novo--Iossifov2014 E
Kosmicki2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More