or
or
Exact

Results for "DPYSL4"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DPYSL4     PN400195chr10:
134012377-134012377
GAexonicUnknownnonsynonymous SNVNM_006426c.G713Ap.R238Q29.9-Leblond2019 E
DPYSL4     13302.p1chr10:
134010619-134010642
GGGCTGCCGTGGGGCAGGCACAGGGintronicDe novo--Iossifov2012 E
DPYSL4     PN400287chr10:
134012377-134012377
GAexonicUnknownnonsynonymous SNVNM_006426c.G713Ap.R238Q29.9-Leblond2019 E
DPYSL4     iHART1346chr10:
134012376-134012376
CTexonicPaternalstopgainNM_006426c.C712Tp.R238X32.08.413E-6Ruzzo2019 G
DPYSL4     iHART1347chr10:
134012376-134012376
CTexonicPaternalstopgainNM_006426c.C712Tp.R238X32.08.413E-6Ruzzo2019 G
DPYSL4     PN400488chr10:
134012377-134012377
GAexonicUnknownnonsynonymous SNVNM_006426c.G713Ap.R238Q29.9-Leblond2019 E
DPYSL4     iHART1348chr10:
134012376-134012376
CTexonicPaternalstopgainNM_006426c.C712Tp.R238X32.08.413E-6Ruzzo2019 G
DPYSL4     PN400489chr10:
134012377-134012377
GAexonicUnknownnonsynonymous SNVNM_006426c.G713Ap.R238Q29.9-Leblond2019 E
DPYSL4     PN400128chr10:
134012377-134012377
GAexonicUnknownnonsynonymous SNVNM_006426c.G713Ap.R238Q29.9-Leblond2019 E
DPYSL4     04C29183chr10:
134006211-134006211
GAexonicDe novononsynonymous SNVNM_006426c.G178Ap.A60T31.0-Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More